Incidental Mutation 'R7460:Vps45'
ID578373
Institutional Source Beutler Lab
Gene Symbol Vps45
Ensembl Gene ENSMUSG00000015747
Gene Namevacuolar protein sorting 45
SynonymsmVps45
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.896) question?
Stock #R7460 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location95999832-96058466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96048387 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 97 (Y97F)
Ref Sequence ENSEMBL: ENSMUSP00000015891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015891]
Predicted Effect probably benign
Transcript: ENSMUST00000015891
AA Change: Y97F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000015891
Gene: ENSMUSG00000015747
AA Change: Y97F

DomainStartEndE-ValueType
Pfam:Sec1 23 546 3e-119 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec1 domain family, and shows a high degree of sequence similarity to mouse, rat and yeast Vps45. The exact function of this gene is not known, but its high expression in peripheral blood mononuclear cells suggests a role in trafficking proteins, including inflammatory mediators. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,254,648 N625D probably benign Het
Abi2 T A 1: 60,434,307 V61D probably damaging Het
Agrn C A 4: 156,174,424 V915L probably damaging Het
Arhgap24 T C 5: 102,892,346 V476A probably benign Het
Arhgef15 A G 11: 68,947,035 L720P probably damaging Het
Atad2b C A 12: 4,952,660 R343S probably benign Het
Atxn3 T A 12: 101,926,517 T313S probably benign Het
BC037034 G A 5: 138,262,729 T218M probably benign Het
BC051665 T C 13: 60,784,643 E76G probably benign Het
Birc2 A T 9: 7,818,761 F610I probably damaging Het
Cdh16 A T 8: 104,622,291 V58D possibly damaging Het
Cenpf T C 1: 189,654,050 D2011G probably damaging Het
Ddb1 T C 19: 10,607,911 probably null Het
Ddx1 A G 12: 13,231,439 probably null Het
Disp2 A G 2: 118,789,780 H331R probably damaging Het
Dmxl1 A G 18: 49,878,612 T1279A probably benign Het
Dync1i2 T C 2: 71,250,886 I473T probably damaging Het
Fam114a1 T G 5: 65,038,707 V520G possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat2 T A 11: 55,278,963 D2990V probably damaging Het
Fbxo18 C T 2: 11,756,685 G597D probably benign Het
Fdxr A C 11: 115,276,854 S12A probably benign Het
Fgf14 T A 14: 124,676,693 R9W possibly damaging Het
Gnat3 A T 5: 17,999,658 D103V Het
Hepacam2 G A 6: 3,487,199 P53S probably benign Het
Jmjd1c A G 10: 67,217,036 T21A probably benign Het
Lama1 T C 17: 67,767,018 C930R Het
Lrp1b T C 2: 40,598,466 T4536A Het
Lrrc27 T A 7: 139,223,658 V166E probably damaging Het
Mapk10 C T 5: 103,038,577 V90I probably benign Het
Mfsd14b C T 13: 65,072,023 G339D probably damaging Het
Mkl2 G T 16: 13,400,976 Q495H probably benign Het
Mnt T A 11: 74,843,283 M580K unknown Het
Mrc1 T C 2: 14,248,869 S234P probably damaging Het
Mrps5 G A 2: 127,591,891 V75I not run Het
Myo10 A G 15: 25,807,827 D1845G probably damaging Het
Olfr147 T C 9: 38,403,353 S160P possibly damaging Het
Olfr19 C A 16: 16,673,166 A272S possibly damaging Het
Olfr402 A T 11: 74,155,846 I231F probably damaging Het
Olfr559 A T 7: 102,723,821 M223K probably benign Het
Pdhx G A 2: 103,046,779 T95M probably damaging Het
Pigb C T 9: 73,038,675 V72I probably damaging Het
Prr7 C A 13: 55,472,353 P110Q unknown Het
Psg22 A G 7: 18,724,404 D340G probably benign Het
Ptprn2 T C 12: 117,248,681 S908P probably benign Het
Ros1 T C 10: 52,118,203 Y1348C probably damaging Het
Rspry1 T C 8: 94,650,335 I506T probably benign Het
Ryr2 T A 13: 11,705,710 Y2684F probably benign Het
Sdr16c6 A G 4: 4,076,575 probably null Het
Senp7 A G 16: 56,173,182 T743A possibly damaging Het
Slc6a20b T C 9: 123,604,949 I275V probably benign Het
Slc6a7 A G 18: 61,001,602 I467T probably benign Het
Tacc2 A G 7: 130,624,633 D1016G probably benign Het
Thsd7a A G 6: 12,554,934 V317A Het
Tle3 A G 9: 61,413,084 H598R probably damaging Het
Tmem102 A G 11: 69,804,123 L341P probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Trhde T A 10: 114,413,263 D866V probably damaging Het
Ttn A G 2: 76,751,273 I23092T probably damaging Het
U2surp C A 9: 95,462,824 V944L unknown Het
Urgcp T C 11: 5,716,622 H615R possibly damaging Het
Zc3h12c T C 9: 52,144,102 T136A probably benign Het
Zfp948 A T 17: 21,588,415 H623L probably damaging Het
Other mutations in Vps45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Vps45 APN 3 96000066 makesense probably null
IGL00848:Vps45 APN 3 96056973 splice site probably benign
IGL00915:Vps45 APN 3 96046350 critical splice donor site probably null
IGL02143:Vps45 APN 3 96033821 missense probably benign
IGL02143:Vps45 APN 3 96019646 missense probably benign 0.00
IGL02247:Vps45 APN 3 96042924 missense probably damaging 1.00
IGL02598:Vps45 APN 3 96031042 missense probably benign 0.03
IGL03409:Vps45 APN 3 96053089 missense probably benign 0.00
R0943:Vps45 UTSW 3 96057024 missense probably benign 0.02
R1102:Vps45 UTSW 3 96042941 splice site probably benign
R1540:Vps45 UTSW 3 96048346 missense probably damaging 1.00
R1829:Vps45 UTSW 3 96047245 critical splice donor site probably null
R1919:Vps45 UTSW 3 96046440 missense probably benign 0.00
R2113:Vps45 UTSW 3 96047053 missense probably benign 0.05
R2251:Vps45 UTSW 3 96057040 missense probably benign 0.00
R2511:Vps45 UTSW 3 96041445 missense probably benign 0.01
R4752:Vps45 UTSW 3 96048387 missense possibly damaging 0.88
R4806:Vps45 UTSW 3 96046413 missense probably benign 0.01
R4914:Vps45 UTSW 3 96019631 missense probably damaging 0.98
R4915:Vps45 UTSW 3 96019631 missense probably damaging 0.98
R4917:Vps45 UTSW 3 96019631 missense probably damaging 0.98
R5180:Vps45 UTSW 3 96046371 missense possibly damaging 0.94
R5288:Vps45 UTSW 3 96057774 start codon destroyed probably null 1.00
R5454:Vps45 UTSW 3 96019657 missense probably benign 0.21
R6397:Vps45 UTSW 3 96042852 missense probably benign 0.13
R7247:Vps45 UTSW 3 96041405 missense probably benign 0.02
R7449:Vps45 UTSW 3 96047136 critical splice acceptor site probably null
R7795:Vps45 UTSW 3 96019624 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGCACATTGATTTTGTCTGACCAG -3'
(R):5'- ACAGGTTATTCAGTGAGGAATTGG -3'

Sequencing Primer
(F):5'- AGACAGCACCTTCCTTATTTTTAGAC -3'
(R):5'- GGGGTGACGTATTCTATCATTCAC -3'
Posted On2019-10-07