Incidental Mutation 'R7460:Mapk10'
ID578379
Institutional Source Beutler Lab
Gene Symbol Mapk10
Ensembl Gene ENSMUSG00000046709
Gene Namemitogen-activated protein kinase 10
Synonymsp493F12, JNK3, Serk2, C230008H04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7460 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location102907948-103211334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103038577 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 90 (V90I)
Ref Sequence ENSEMBL: ENSMUSP00000108469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086854] [ENSMUST00000112846] [ENSMUST00000112847] [ENSMUST00000112848] [ENSMUST00000133069] [ENSMUST00000141573] [ENSMUST00000170792]
Predicted Effect probably benign
Transcript: ENSMUST00000086854
AA Change: V60I

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000084065
Gene: ENSMUSG00000046709
AA Change: V60I

DomainStartEndE-ValueType
S_TKc 64 359 5.76e-88 SMART
low complexity region 423 432 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112846
AA Change: V60I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108467
Gene: ENSMUSG00000046709
AA Change: V60I

DomainStartEndE-ValueType
S_TKc 64 359 4.37e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112847
AA Change: V60I

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000108468
Gene: ENSMUSG00000046709
AA Change: V60I

DomainStartEndE-ValueType
S_TKc 64 359 4.37e-88 SMART
low complexity region 423 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112848
AA Change: V90I

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108469
Gene: ENSMUSG00000046709
AA Change: V90I

DomainStartEndE-ValueType
S_TKc 94 389 4.37e-88 SMART
low complexity region 453 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133069
AA Change: V60I

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143609
Gene: ENSMUSG00000046709
AA Change: V60I

DomainStartEndE-ValueType
S_TKc 64 252 1.4e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000141573
AA Change: V60I

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142798
Gene: ENSMUSG00000046709
AA Change: V60I

DomainStartEndE-ValueType
Pfam:Pkinase 64 125 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170792
AA Change: V60I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000127193
Gene: ENSMUSG00000046709
AA Change: V60I

DomainStartEndE-ValueType
S_TKc 64 359 4.37e-88 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as integration points for multiple biochemical signals and are involved in a wide variety of cellular processes, such as proliferation, differentiation, transcription regulation and development. This kinase is specifically expressed in a subset of neurons in the nervous system and is activated by threonine and tyrosine phosphorylation. Targeted deletion of this gene in mice suggests that it may have a role in stress-induced neuronal apoptosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. They are resistant to kainic acid induced seizures and show increased resistance to MPTP induced Parkinson's disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,254,648 N625D probably benign Het
Abi2 T A 1: 60,434,307 V61D probably damaging Het
Agrn C A 4: 156,174,424 V915L probably damaging Het
Arhgap24 T C 5: 102,892,346 V476A probably benign Het
Arhgef15 A G 11: 68,947,035 L720P probably damaging Het
Atad2b C A 12: 4,952,660 R343S probably benign Het
Atxn3 T A 12: 101,926,517 T313S probably benign Het
BC037034 G A 5: 138,262,729 T218M probably benign Het
BC051665 T C 13: 60,784,643 E76G probably benign Het
Birc2 A T 9: 7,818,761 F610I probably damaging Het
Cdh16 A T 8: 104,622,291 V58D possibly damaging Het
Cenpf T C 1: 189,654,050 D2011G probably damaging Het
Ddb1 T C 19: 10,607,911 probably null Het
Ddx1 A G 12: 13,231,439 probably null Het
Disp2 A G 2: 118,789,780 H331R probably damaging Het
Dmxl1 A G 18: 49,878,612 T1279A probably benign Het
Dync1i2 T C 2: 71,250,886 I473T probably damaging Het
Fam114a1 T G 5: 65,038,707 V520G possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat2 T A 11: 55,278,963 D2990V probably damaging Het
Fbxo18 C T 2: 11,756,685 G597D probably benign Het
Fdxr A C 11: 115,276,854 S12A probably benign Het
Fgf14 T A 14: 124,676,693 R9W possibly damaging Het
Gnat3 A T 5: 17,999,658 D103V Het
Hepacam2 G A 6: 3,487,199 P53S probably benign Het
Jmjd1c A G 10: 67,217,036 T21A probably benign Het
Lama1 T C 17: 67,767,018 C930R Het
Lrp1b T C 2: 40,598,466 T4536A Het
Lrrc27 T A 7: 139,223,658 V166E probably damaging Het
Mfsd14b C T 13: 65,072,023 G339D probably damaging Het
Mkl2 G T 16: 13,400,976 Q495H probably benign Het
Mnt T A 11: 74,843,283 M580K unknown Het
Mrc1 T C 2: 14,248,869 S234P probably damaging Het
Mrps5 G A 2: 127,591,891 V75I not run Het
Myo10 A G 15: 25,807,827 D1845G probably damaging Het
Olfr147 T C 9: 38,403,353 S160P possibly damaging Het
Olfr19 C A 16: 16,673,166 A272S possibly damaging Het
Olfr402 A T 11: 74,155,846 I231F probably damaging Het
Olfr559 A T 7: 102,723,821 M223K probably benign Het
Pdhx G A 2: 103,046,779 T95M probably damaging Het
Pigb C T 9: 73,038,675 V72I probably damaging Het
Prr7 C A 13: 55,472,353 P110Q unknown Het
Psg22 A G 7: 18,724,404 D340G probably benign Het
Ptprn2 T C 12: 117,248,681 S908P probably benign Het
Ros1 T C 10: 52,118,203 Y1348C probably damaging Het
Rspry1 T C 8: 94,650,335 I506T probably benign Het
Ryr2 T A 13: 11,705,710 Y2684F probably benign Het
Sdr16c6 A G 4: 4,076,575 probably null Het
Senp7 A G 16: 56,173,182 T743A possibly damaging Het
Slc6a20b T C 9: 123,604,949 I275V probably benign Het
Slc6a7 A G 18: 61,001,602 I467T probably benign Het
Tacc2 A G 7: 130,624,633 D1016G probably benign Het
Thsd7a A G 6: 12,554,934 V317A Het
Tle3 A G 9: 61,413,084 H598R probably damaging Het
Tmem102 A G 11: 69,804,123 L341P probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Trhde T A 10: 114,413,263 D866V probably damaging Het
Ttn A G 2: 76,751,273 I23092T probably damaging Het
U2surp C A 9: 95,462,824 V944L unknown Het
Urgcp T C 11: 5,716,622 H615R possibly damaging Het
Vps45 T A 3: 96,048,387 Y97F probably benign Het
Zc3h12c T C 9: 52,144,102 T136A probably benign Het
Zfp948 A T 17: 21,588,415 H623L probably damaging Het
Other mutations in Mapk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Mapk10 APN 5 102926152 splice site probably benign
IGL01791:Mapk10 APN 5 102996648 missense probably damaging 1.00
IGL01885:Mapk10 APN 5 102996589 missense probably damaging 1.00
IGL02192:Mapk10 APN 5 102989647 missense probably damaging 0.97
IGL02260:Mapk10 APN 5 103038668 missense probably benign 0.09
IGL02409:Mapk10 APN 5 102928230 missense possibly damaging 0.50
IGL03148:Mapk10 APN 5 102926105 missense probably damaging 1.00
R0904:Mapk10 UTSW 5 102987280 splice site probably benign
R1067:Mapk10 UTSW 5 102991857 splice site probably benign
R1592:Mapk10 UTSW 5 103038621 missense possibly damaging 0.89
R1812:Mapk10 UTSW 5 102913262 missense probably damaging 1.00
R2364:Mapk10 UTSW 5 103038641 missense possibly damaging 0.81
R2866:Mapk10 UTSW 5 103038682 missense probably benign 0.25
R2867:Mapk10 UTSW 5 103038682 missense probably benign 0.25
R2867:Mapk10 UTSW 5 103038682 missense probably benign 0.25
R4622:Mapk10 UTSW 5 102989724 missense probably damaging 1.00
R4860:Mapk10 UTSW 5 102990619 missense probably damaging 1.00
R4860:Mapk10 UTSW 5 102990619 missense probably damaging 1.00
R4866:Mapk10 UTSW 5 102963525 missense probably damaging 1.00
R5901:Mapk10 UTSW 5 102913292 missense probably damaging 1.00
R5986:Mapk10 UTSW 5 103038580 missense probably benign 0.33
R6000:Mapk10 UTSW 5 102966475 missense probably damaging 1.00
R6000:Mapk10 UTSW 5 102966476 missense probably damaging 1.00
R7375:Mapk10 UTSW 5 102976390 missense probably null 0.26
R7753:Mapk10 UTSW 5 103038553 nonsense probably null
R7879:Mapk10 UTSW 5 102963496 missense probably benign 0.10
R7962:Mapk10 UTSW 5 102963496 missense probably benign 0.10
R8059:Mapk10 UTSW 5 102966612 missense not run
Z1176:Mapk10 UTSW 5 102991887 missense not run
Predicted Primers PCR Primer
(F):5'- TTGTCCCTGTCCGCAGATAC -3'
(R):5'- CAGATGCGTGTAACCATCGG -3'

Sequencing Primer
(F):5'- CCTGTCCGCAGATACAGTTG -3'
(R):5'- CGGAAGAAAAGACTTCTCTGTGTCC -3'
Posted On2019-10-07