Incidental Mutation 'R7460:Hepacam2'
ID578381
Institutional Source Beutler Lab
Gene Symbol Hepacam2
Ensembl Gene ENSMUSG00000044156
Gene NameHEPACAM family member 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R7460 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location3457096-3498298 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3487199 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 53 (P53S)
Ref Sequence ENSEMBL: ENSMUSP00000058882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049985] [ENSMUST00000200854] [ENSMUST00000201607]
Predicted Effect probably benign
Transcript: ENSMUST00000049985
AA Change: P53S

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000058882
Gene: ENSMUSG00000044156
AA Change: P53S

DomainStartEndE-ValueType
IG 39 142 7.77e-1 SMART
IGc2 165 227 6.21e-9 SMART
IG 256 334 1.87e0 SMART
transmembrane domain 351 373 N/A INTRINSIC
low complexity region 420 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200854
SMART Domains Protein: ENSMUSP00000144362
Gene: ENSMUSG00000044156

DomainStartEndE-ValueType
IG_like 2 66 2.88e1 SMART
IGc2 89 151 6.21e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201607
SMART Domains Protein: ENSMUSP00000143834
Gene: ENSMUSG00000044156

DomainStartEndE-ValueType
IG_like 2 66 1.2e-1 SMART
IGc2 89 151 2.5e-11 SMART
Blast:IG 180 206 9e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to the immunoglobulin superfamily that plays a role in mitosis. Knockdown of this gene results in prometaphase arrest, abnormal nuclear morphology and apoptosis. Poly(ADP-ribosylation) of the encoded protein promotes its translocation to centrosomes, which may stimulate centrosome maturation. A chromosomal deletion including this gene may be associated with myeloid leukemia and myelodysplastic syndrome in human patients. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,254,648 N625D probably benign Het
Abi2 T A 1: 60,434,307 V61D probably damaging Het
Agrn C A 4: 156,174,424 V915L probably damaging Het
Arhgap24 T C 5: 102,892,346 V476A probably benign Het
Arhgef15 A G 11: 68,947,035 L720P probably damaging Het
Atad2b C A 12: 4,952,660 R343S probably benign Het
Atxn3 T A 12: 101,926,517 T313S probably benign Het
BC037034 G A 5: 138,262,729 T218M probably benign Het
BC051665 T C 13: 60,784,643 E76G probably benign Het
Birc2 A T 9: 7,818,761 F610I probably damaging Het
Cdh16 A T 8: 104,622,291 V58D possibly damaging Het
Cenpf T C 1: 189,654,050 D2011G probably damaging Het
Ddb1 T C 19: 10,607,911 probably null Het
Ddx1 A G 12: 13,231,439 probably null Het
Disp2 A G 2: 118,789,780 H331R probably damaging Het
Dmxl1 A G 18: 49,878,612 T1279A probably benign Het
Dync1i2 T C 2: 71,250,886 I473T probably damaging Het
Fam114a1 T G 5: 65,038,707 V520G possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat2 T A 11: 55,278,963 D2990V probably damaging Het
Fbxo18 C T 2: 11,756,685 G597D probably benign Het
Fdxr A C 11: 115,276,854 S12A probably benign Het
Fgf14 T A 14: 124,676,693 R9W possibly damaging Het
Gnat3 A T 5: 17,999,658 D103V Het
Jmjd1c A G 10: 67,217,036 T21A probably benign Het
Lama1 T C 17: 67,767,018 C930R Het
Lrp1b T C 2: 40,598,466 T4536A Het
Lrrc27 T A 7: 139,223,658 V166E probably damaging Het
Mapk10 C T 5: 103,038,577 V90I probably benign Het
Mfsd14b C T 13: 65,072,023 G339D probably damaging Het
Mkl2 G T 16: 13,400,976 Q495H probably benign Het
Mnt T A 11: 74,843,283 M580K unknown Het
Mrc1 T C 2: 14,248,869 S234P probably damaging Het
Mrps5 G A 2: 127,591,891 V75I not run Het
Myo10 A G 15: 25,807,827 D1845G probably damaging Het
Olfr147 T C 9: 38,403,353 S160P possibly damaging Het
Olfr19 C A 16: 16,673,166 A272S possibly damaging Het
Olfr402 A T 11: 74,155,846 I231F probably damaging Het
Olfr559 A T 7: 102,723,821 M223K probably benign Het
Pdhx G A 2: 103,046,779 T95M probably damaging Het
Pigb C T 9: 73,038,675 V72I probably damaging Het
Prr7 C A 13: 55,472,353 P110Q unknown Het
Psg22 A G 7: 18,724,404 D340G probably benign Het
Ptprn2 T C 12: 117,248,681 S908P probably benign Het
Ros1 T C 10: 52,118,203 Y1348C probably damaging Het
Rspry1 T C 8: 94,650,335 I506T probably benign Het
Ryr2 T A 13: 11,705,710 Y2684F probably benign Het
Sdr16c6 A G 4: 4,076,575 probably null Het
Senp7 A G 16: 56,173,182 T743A possibly damaging Het
Slc6a20b T C 9: 123,604,949 I275V probably benign Het
Slc6a7 A G 18: 61,001,602 I467T probably benign Het
Tacc2 A G 7: 130,624,633 D1016G probably benign Het
Thsd7a A G 6: 12,554,934 V317A Het
Tle3 A G 9: 61,413,084 H598R probably damaging Het
Tmem102 A G 11: 69,804,123 L341P probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Trhde T A 10: 114,413,263 D866V probably damaging Het
Ttn A G 2: 76,751,273 I23092T probably damaging Het
U2surp C A 9: 95,462,824 V944L unknown Het
Urgcp T C 11: 5,716,622 H615R possibly damaging Het
Vps45 T A 3: 96,048,387 Y97F probably benign Het
Zc3h12c T C 9: 52,144,102 T136A probably benign Het
Zfp948 A T 17: 21,588,415 H623L probably damaging Het
Other mutations in Hepacam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01937:Hepacam2 APN 6 3487117 missense probably benign 0.07
IGL01945:Hepacam2 APN 6 3487117 missense probably benign 0.07
IGL02254:Hepacam2 APN 6 3483421 missense probably benign 0.06
IGL02445:Hepacam2 APN 6 3483481 missense probably damaging 1.00
IGL02546:Hepacam2 APN 6 3483568 missense possibly damaging 0.93
IGL02620:Hepacam2 APN 6 3487280 splice site probably benign
IGL02697:Hepacam2 APN 6 3476036 missense possibly damaging 0.79
R0089:Hepacam2 UTSW 6 3487094 missense probably damaging 0.96
R0208:Hepacam2 UTSW 6 3467505 splice site probably benign
R0230:Hepacam2 UTSW 6 3463336 missense probably benign 0.01
R0299:Hepacam2 UTSW 6 3476121 missense probably damaging 1.00
R0499:Hepacam2 UTSW 6 3476121 missense probably damaging 1.00
R0608:Hepacam2 UTSW 6 3483479 missense possibly damaging 0.93
R1350:Hepacam2 UTSW 6 3467530 nonsense probably null
R1663:Hepacam2 UTSW 6 3483439 missense possibly damaging 0.76
R1749:Hepacam2 UTSW 6 3483379 missense probably damaging 1.00
R1997:Hepacam2 UTSW 6 3487241 missense probably damaging 1.00
R2146:Hepacam2 UTSW 6 3463378 splice site probably benign
R3911:Hepacam2 UTSW 6 3494477 start codon destroyed probably null 0.98
R4281:Hepacam2 UTSW 6 3475938 missense probably damaging 0.98
R4290:Hepacam2 UTSW 6 3487237 missense probably benign 0.01
R4371:Hepacam2 UTSW 6 3486988 missense probably damaging 1.00
R4794:Hepacam2 UTSW 6 3475933 missense probably damaging 0.96
R4890:Hepacam2 UTSW 6 3487231 missense probably damaging 0.96
R5330:Hepacam2 UTSW 6 3483377 missense probably benign 0.00
R5331:Hepacam2 UTSW 6 3483377 missense probably benign 0.00
R5677:Hepacam2 UTSW 6 3466142 missense probably damaging 1.00
R5796:Hepacam2 UTSW 6 3466200 unclassified probably null
R5844:Hepacam2 UTSW 6 3476073 missense probably damaging 0.99
R5979:Hepacam2 UTSW 6 3476149 missense probably damaging 1.00
R6017:Hepacam2 UTSW 6 3483332 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTCCCCTGGATGTTGACC -3'
(R):5'- GGGACTACCATCTGACTGAGTTC -3'

Sequencing Primer
(F):5'- GATGTAATTGCCCTCATCGGTGAAC -3'
(R):5'- GAGTTCTCTCTGCAACCGAAC -3'
Posted On2019-10-07