Incidental Mutation 'R7460:Birc2'
ID578390
Institutional Source Beutler Lab
Gene Symbol Birc2
Ensembl Gene ENSMUSG00000057367
Gene Namebaculoviral IAP repeat-containing 2
SynonymscIAP-1, Api1, HIAP1, IAP1, MIAP1, mcIAP1, MIHB, cIAP1
MMRRC Submission
Accession Numbers

Genbank: NM_007465.2; Ensembl: ENSMUST00000074246

Is this an essential gene? Probably essential (E-score: 0.870) question?
Stock #R7460 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location7818227-7837064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7818761 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 610 (F610I)
Ref Sequence ENSEMBL: ENSMUSP00000091422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074246] [ENSMUST00000190341]
Predicted Effect probably damaging
Transcript: ENSMUST00000074246
AA Change: F610I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091422
Gene: ENSMUSG00000057367
AA Change: F610I

DomainStartEndE-ValueType
BIR 44 115 4.06e-33 SMART
BIR 175 245 4.25e-36 SMART
BIR 260 331 2.24e-35 SMART
low complexity region 432 446 N/A INTRINSIC
CARD 447 535 1.64e-20 SMART
low complexity region 552 563 N/A INTRINSIC
RING 565 599 1.65e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190341
AA Change: F610I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140049
Gene: ENSMUSG00000057367
AA Change: F610I

DomainStartEndE-ValueType
BIR 44 115 4.06e-33 SMART
BIR 175 245 4.25e-36 SMART
BIR 260 331 2.24e-35 SMART
low complexity region 432 446 N/A INTRINSIC
CARD 447 535 1.64e-20 SMART
low complexity region 552 563 N/A INTRINSIC
RING 565 599 1.65e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice showed a modest reduction in the number of lymphocytes. Mice homozygous for a knock-in allele exhibit increased T cell poliferation and IFNG secretion in response to anti-CD3 stimulation. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Gene trapped(2)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,254,648 N625D probably benign Het
Abi2 T A 1: 60,434,307 V61D probably damaging Het
Agrn C A 4: 156,174,424 V915L probably damaging Het
Arhgap24 T C 5: 102,892,346 V476A probably benign Het
Arhgef15 A G 11: 68,947,035 L720P probably damaging Het
Atad2b C A 12: 4,952,660 R343S probably benign Het
Atxn3 T A 12: 101,926,517 T313S probably benign Het
BC037034 G A 5: 138,262,729 T218M probably benign Het
BC051665 T C 13: 60,784,643 E76G probably benign Het
Cdh16 A T 8: 104,622,291 V58D possibly damaging Het
Cenpf T C 1: 189,654,050 D2011G probably damaging Het
Ddb1 T C 19: 10,607,911 probably null Het
Ddx1 A G 12: 13,231,439 probably null Het
Disp2 A G 2: 118,789,780 H331R probably damaging Het
Dmxl1 A G 18: 49,878,612 T1279A probably benign Het
Dync1i2 T C 2: 71,250,886 I473T probably damaging Het
Fam114a1 T G 5: 65,038,707 V520G possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat2 T A 11: 55,278,963 D2990V probably damaging Het
Fbxo18 C T 2: 11,756,685 G597D probably benign Het
Fdxr A C 11: 115,276,854 S12A probably benign Het
Fgf14 T A 14: 124,676,693 R9W possibly damaging Het
Gnat3 A T 5: 17,999,658 D103V Het
Hepacam2 G A 6: 3,487,199 P53S probably benign Het
Jmjd1c A G 10: 67,217,036 T21A probably benign Het
Lama1 T C 17: 67,767,018 C930R Het
Lrp1b T C 2: 40,598,466 T4536A Het
Lrrc27 T A 7: 139,223,658 V166E probably damaging Het
Mapk10 C T 5: 103,038,577 V90I probably benign Het
Mfsd14b C T 13: 65,072,023 G339D probably damaging Het
Mkl2 G T 16: 13,400,976 Q495H probably benign Het
Mnt T A 11: 74,843,283 M580K unknown Het
Mrc1 T C 2: 14,248,869 S234P probably damaging Het
Mrps5 G A 2: 127,591,891 V75I not run Het
Myo10 A G 15: 25,807,827 D1845G probably damaging Het
Olfr147 T C 9: 38,403,353 S160P possibly damaging Het
Olfr19 C A 16: 16,673,166 A272S possibly damaging Het
Olfr402 A T 11: 74,155,846 I231F probably damaging Het
Olfr559 A T 7: 102,723,821 M223K probably benign Het
Pdhx G A 2: 103,046,779 T95M probably damaging Het
Pigb C T 9: 73,038,675 V72I probably damaging Het
Prr7 C A 13: 55,472,353 P110Q unknown Het
Psg22 A G 7: 18,724,404 D340G probably benign Het
Ptprn2 T C 12: 117,248,681 S908P probably benign Het
Ros1 T C 10: 52,118,203 Y1348C probably damaging Het
Rspry1 T C 8: 94,650,335 I506T probably benign Het
Ryr2 T A 13: 11,705,710 Y2684F probably benign Het
Sdr16c6 A G 4: 4,076,575 probably null Het
Senp7 A G 16: 56,173,182 T743A possibly damaging Het
Slc6a20b T C 9: 123,604,949 I275V probably benign Het
Slc6a7 A G 18: 61,001,602 I467T probably benign Het
Tacc2 A G 7: 130,624,633 D1016G probably benign Het
Thsd7a A G 6: 12,554,934 V317A Het
Tle3 A G 9: 61,413,084 H598R probably damaging Het
Tmem102 A G 11: 69,804,123 L341P probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Trhde T A 10: 114,413,263 D866V probably damaging Het
Ttn A G 2: 76,751,273 I23092T probably damaging Het
U2surp C A 9: 95,462,824 V944L unknown Het
Urgcp T C 11: 5,716,622 H615R possibly damaging Het
Vps45 T A 3: 96,048,387 Y97F probably benign Het
Zc3h12c T C 9: 52,144,102 T136A probably benign Het
Zfp948 A T 17: 21,588,415 H623L probably damaging Het
Other mutations in Birc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Birc2 APN 9 7833665 missense probably damaging 1.00
IGL00972:Birc2 APN 9 7833715 missense probably benign 0.36
IGL02888:Birc2 APN 9 7819558 missense probably benign 0.22
IGL03399:Birc2 APN 9 7821087 missense probably damaging 1.00
1mM(1):Birc2 UTSW 9 7819408 missense probably damaging 0.98
R0409:Birc2 UTSW 9 7819384 missense possibly damaging 0.61
R1617:Birc2 UTSW 9 7826951 missense possibly damaging 0.66
R1864:Birc2 UTSW 9 7819517 missense probably benign 0.06
R2156:Birc2 UTSW 9 7826938 missense probably damaging 1.00
R2519:Birc2 UTSW 9 7821179 missense possibly damaging 0.46
R2867:Birc2 UTSW 9 7834477 start codon destroyed probably null 0.08
R2867:Birc2 UTSW 9 7834477 start codon destroyed probably null 0.08
R4028:Birc2 UTSW 9 7819351 missense probably benign 0.01
R4243:Birc2 UTSW 9 7834385 missense probably benign 0.00
R4250:Birc2 UTSW 9 7818935 missense probably benign 0.00
R4584:Birc2 UTSW 9 7833674 missense probably damaging 1.00
R4952:Birc2 UTSW 9 7836740 missense probably damaging 0.99
R5017:Birc2 UTSW 9 7818885 nonsense probably null
R6163:Birc2 UTSW 9 7819035 missense probably benign 0.15
R6789:Birc2 UTSW 9 7836965 intron probably benign
R6795:Birc2 UTSW 9 7833872 missense possibly damaging 0.81
R6941:Birc2 UTSW 9 7819468 missense probably benign 0.00
R7105:Birc2 UTSW 9 7819441 missense probably damaging 1.00
R7135:Birc2 UTSW 9 7818761 missense probably damaging 1.00
R7233:Birc2 UTSW 9 7827008 missense probably damaging 1.00
R7517:Birc2 UTSW 9 7819423 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACAGACACAGTCCTGTAGC -3'
(R):5'- CTCAGGCTTGTCATTGGAAGAG -3'

Sequencing Primer
(F):5'- CAGTCCTGTAGCTCAACAGC -3'
(R):5'- GTCATTGGAAGAGCAGTTGC -3'
Posted On2019-10-07