Incidental Mutation 'R7460:Or8b3'
ID 578391
Institutional Source Beutler Lab
Gene Symbol Or8b3
Ensembl Gene ENSMUSG00000049098
Gene Name olfactory receptor family 8 subfamily B member 3
Synonyms MOR164-1, M3, GA_x6K02T2PVTD-32098059-32099003, Olfr147
MMRRC Submission 045534-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R7460 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 38313007-38315125 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38314649 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 160 (S160P)
Ref Sequence ENSEMBL: ENSMUSP00000051933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056364] [ENSMUST00000214648]
AlphaFold Q60886
Predicted Effect possibly damaging
Transcript: ENSMUST00000056364
AA Change: S160P

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000051933
Gene: ENSMUSG00000049098
AA Change: S160P

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 1.2e-48 PFAM
Pfam:7tm_1 44 292 2.8e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214648
AA Change: S157P

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi2 T A 1: 60,473,466 (GRCm39) V61D probably damaging Het
Agrn C A 4: 156,258,881 (GRCm39) V915L probably damaging Het
Arhgap24 T C 5: 103,040,212 (GRCm39) V476A probably benign Het
Arhgef15 A G 11: 68,837,861 (GRCm39) L720P probably damaging Het
Atad2b C A 12: 5,002,660 (GRCm39) R343S probably benign Het
Atxn3 T A 12: 101,892,776 (GRCm39) T313S probably benign Het
BC051665 T C 13: 60,932,457 (GRCm39) E76G probably benign Het
Birc2 A T 9: 7,818,762 (GRCm39) F610I probably damaging Het
Cdh16 A T 8: 105,348,923 (GRCm39) V58D possibly damaging Het
Cenpf T C 1: 189,386,247 (GRCm39) D2011G probably damaging Het
Ddb1 T C 19: 10,585,275 (GRCm39) probably null Het
Ddx1 A G 12: 13,281,440 (GRCm39) probably null Het
Disp2 A G 2: 118,620,261 (GRCm39) H331R probably damaging Het
Dmxl1 A G 18: 50,011,679 (GRCm39) T1279A probably benign Het
Dync1i2 T C 2: 71,081,230 (GRCm39) I473T probably damaging Het
Fam114a1 T G 5: 65,196,050 (GRCm39) V520G possibly damaging Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fat2 T A 11: 55,169,789 (GRCm39) D2990V probably damaging Het
Fbh1 C T 2: 11,761,496 (GRCm39) G597D probably benign Het
Fdxr A C 11: 115,167,680 (GRCm39) S12A probably benign Het
Fgf14 T A 14: 124,914,105 (GRCm39) R9W possibly damaging Het
Gnat3 A T 5: 18,204,656 (GRCm39) D103V Het
Hepacam2 G A 6: 3,487,199 (GRCm39) P53S probably benign Het
Inhca T C 9: 103,131,847 (GRCm39) N625D probably benign Het
Jmjd1c A G 10: 67,052,815 (GRCm39) T21A probably benign Het
Lama1 T C 17: 68,074,013 (GRCm39) C930R Het
Lrp1b T C 2: 40,488,478 (GRCm39) T4536A Het
Lrrc27 T A 7: 138,803,574 (GRCm39) V166E probably damaging Het
Mapk10 C T 5: 103,186,443 (GRCm39) V90I probably benign Het
Mfsd14b C T 13: 65,219,837 (GRCm39) G339D probably damaging Het
Mnt T A 11: 74,734,109 (GRCm39) M580K unknown Het
Mrc1 T C 2: 14,253,680 (GRCm39) S234P probably damaging Het
Mrps5 G A 2: 127,433,811 (GRCm39) V75I not run Het
Mrtfb G T 16: 13,218,840 (GRCm39) Q495H probably benign Het
Myo10 A G 15: 25,807,913 (GRCm39) D1845G probably damaging Het
Or3a1c A T 11: 74,046,672 (GRCm39) I231F probably damaging Het
Or51a25 A T 7: 102,373,028 (GRCm39) M223K probably benign Het
Or7a40 C A 16: 16,491,030 (GRCm39) A272S possibly damaging Het
Pdhx G A 2: 102,877,124 (GRCm39) T95M probably damaging Het
Pigb C T 9: 72,945,957 (GRCm39) V72I probably damaging Het
Prr7 C A 13: 55,620,166 (GRCm39) P110Q unknown Het
Psg22 A G 7: 18,458,329 (GRCm39) D340G probably benign Het
Ptprn2 T C 12: 117,212,301 (GRCm39) S908P probably benign Het
Ros1 T C 10: 51,994,299 (GRCm39) Y1348C probably damaging Het
Rspry1 T C 8: 95,376,963 (GRCm39) I506T probably benign Het
Ryr2 T A 13: 11,720,596 (GRCm39) Y2684F probably benign Het
Sdr16c6 A G 4: 4,076,575 (GRCm39) probably null Het
Senp7 A G 16: 55,993,545 (GRCm39) T743A possibly damaging Het
Slc6a20b T C 9: 123,434,014 (GRCm39) I275V probably benign Het
Slc6a7 A G 18: 61,134,674 (GRCm39) I467T probably benign Het
Tacc2 A G 7: 130,226,363 (GRCm39) D1016G probably benign Het
Thsd7a A G 6: 12,554,933 (GRCm39) V317A Het
Tle3 A G 9: 61,320,366 (GRCm39) H598R probably damaging Het
Tmem102 A G 11: 69,694,949 (GRCm39) L341P probably damaging Het
Tmem94 G T 11: 115,677,082 (GRCm39) R118L possibly damaging Het
Trappc14 G A 5: 138,260,991 (GRCm39) T218M probably benign Het
Trhde T A 10: 114,249,168 (GRCm39) D866V probably damaging Het
Ttn A G 2: 76,581,617 (GRCm39) I23092T probably damaging Het
U2surp C A 9: 95,344,877 (GRCm39) V944L unknown Het
Urgcp T C 11: 5,666,622 (GRCm39) H615R possibly damaging Het
Vps45 T A 3: 95,955,699 (GRCm39) Y97F probably benign Het
Zc3h12c T C 9: 52,055,402 (GRCm39) T136A probably benign Het
Zfp948 A T 17: 21,808,677 (GRCm39) H623L probably damaging Het
Other mutations in Or8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01685:Or8b3 APN 9 38,314,317 (GRCm39) missense possibly damaging 0.67
IGL02109:Or8b3 APN 9 38,314,382 (GRCm39) missense possibly damaging 0.91
IGL02805:Or8b3 APN 9 38,315,132 (GRCm39) utr 3 prime probably benign
IGL02875:Or8b3 APN 9 38,314,472 (GRCm39) missense probably damaging 0.99
R1133:Or8b3 UTSW 9 38,315,027 (GRCm39) missense probably benign 0.00
R1446:Or8b3 UTSW 9 38,314,601 (GRCm39) missense possibly damaging 0.73
R1591:Or8b3 UTSW 9 38,314,232 (GRCm39) missense probably damaging 1.00
R1719:Or8b3 UTSW 9 38,314,550 (GRCm39) missense possibly damaging 0.67
R1895:Or8b3 UTSW 9 38,314,182 (GRCm39) start codon destroyed probably null 0.88
R1946:Or8b3 UTSW 9 38,314,182 (GRCm39) start codon destroyed probably null 0.88
R1981:Or8b3 UTSW 9 38,315,031 (GRCm39) missense probably damaging 0.99
R2033:Or8b3 UTSW 9 38,314,669 (GRCm39) missense probably damaging 0.99
R4856:Or8b3 UTSW 9 38,314,764 (GRCm39) missense probably damaging 1.00
R5322:Or8b3 UTSW 9 38,314,862 (GRCm39) missense probably damaging 1.00
R6017:Or8b3 UTSW 9 38,314,916 (GRCm39) missense probably benign 0.01
R6037:Or8b3 UTSW 9 38,314,601 (GRCm39) missense probably benign 0.07
R6037:Or8b3 UTSW 9 38,314,601 (GRCm39) missense probably benign 0.07
R7032:Or8b3 UTSW 9 38,314,965 (GRCm39) missense possibly damaging 0.53
R7042:Or8b3 UTSW 9 38,314,196 (GRCm39) missense probably damaging 0.98
R7351:Or8b3 UTSW 9 38,314,739 (GRCm39) missense probably damaging 1.00
R7820:Or8b3 UTSW 9 38,314,862 (GRCm39) missense probably damaging 1.00
R8161:Or8b3 UTSW 9 38,314,803 (GRCm39) missense probably damaging 0.97
R8196:Or8b3 UTSW 9 38,314,904 (GRCm39) missense probably damaging 1.00
R9103:Or8b3 UTSW 9 38,314,518 (GRCm39) missense probably damaging 1.00
R9213:Or8b3 UTSW 9 38,315,047 (GRCm39) nonsense probably null
R9717:Or8b3 UTSW 9 38,314,841 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGCATGACTCAACTGTTTC -3'
(R):5'- GCTGAAGGCTTTTGCTCTTC -3'

Sequencing Primer
(F):5'- GTGCATGACTCAACTGTTTCTCTTTC -3'
(R):5'- TTTAGAATGTTGGCAAGGATGAAAAC -3'
Posted On 2019-10-07