Incidental Mutation 'R7460:Urgcp'
ID578401
Institutional Source Beutler Lab
Gene Symbol Urgcp
Ensembl Gene ENSMUSG00000049680
Gene Nameupregulator of cell proliferation
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R7460 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location5713417-5762376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5716622 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 615 (H615R)
Ref Sequence ENSEMBL: ENSMUSP00000091053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053427] [ENSMUST00000093362] [ENSMUST00000118076] [ENSMUST00000120306] [ENSMUST00000140922] [ENSMUST00000170116]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053427
AA Change: H572R

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055821
Gene: ENSMUSG00000049680
AA Change: H572R

DomainStartEndE-ValueType
Blast:PGAM 1 709 N/A BLAST
SCOP:d1h65a_ 627 718 1e-3 SMART
coiled coil region 856 883 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000093362
AA Change: H615R

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091053
Gene: ENSMUSG00000049680
AA Change: H615R

DomainStartEndE-ValueType
Blast:PGAM 15 752 N/A BLAST
SCOP:d1h65a_ 670 761 1e-3 SMART
coiled coil region 899 926 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118076
AA Change: H572R

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113589
Gene: ENSMUSG00000049680
AA Change: H572R

DomainStartEndE-ValueType
Blast:PGAM 1 709 N/A BLAST
SCOP:d1h65a_ 627 718 1e-3 SMART
coiled coil region 856 883 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120306
AA Change: H572R

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113060
Gene: ENSMUSG00000049680
AA Change: H572R

DomainStartEndE-ValueType
Blast:PGAM 1 709 N/A BLAST
SCOP:d1h65a_ 627 718 1e-3 SMART
coiled coil region 856 883 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140922
SMART Domains Protein: ENSMUSP00000120902
Gene: ENSMUSG00000049680

DomainStartEndE-ValueType
Blast:PGAM 1 99 7e-43 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000170116
AA Change: H572R

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133216
Gene: ENSMUSG00000049680
AA Change: H572R

DomainStartEndE-ValueType
Blast:PGAM 1 709 N/A BLAST
SCOP:d1h65a_ 627 718 1e-3 SMART
coiled coil region 856 883 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] URG4 is upregulated in the presence of hepatitis B virus (HBV)-encoded X antigen (HBxAg) and may contribute to the development of hepatocellular carcinoma by promoting hepatocellular growth and survival (Tufan et al., 2002 [PubMed 12082552]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,254,648 N625D probably benign Het
Abi2 T A 1: 60,434,307 V61D probably damaging Het
Agrn C A 4: 156,174,424 V915L probably damaging Het
Arhgap24 T C 5: 102,892,346 V476A probably benign Het
Arhgef15 A G 11: 68,947,035 L720P probably damaging Het
Atad2b C A 12: 4,952,660 R343S probably benign Het
Atxn3 T A 12: 101,926,517 T313S probably benign Het
BC037034 G A 5: 138,262,729 T218M probably benign Het
BC051665 T C 13: 60,784,643 E76G probably benign Het
Birc2 A T 9: 7,818,761 F610I probably damaging Het
Cdh16 A T 8: 104,622,291 V58D possibly damaging Het
Cenpf T C 1: 189,654,050 D2011G probably damaging Het
Ddb1 T C 19: 10,607,911 probably null Het
Ddx1 A G 12: 13,231,439 probably null Het
Disp2 A G 2: 118,789,780 H331R probably damaging Het
Dmxl1 A G 18: 49,878,612 T1279A probably benign Het
Dync1i2 T C 2: 71,250,886 I473T probably damaging Het
Fam114a1 T G 5: 65,038,707 V520G possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat2 T A 11: 55,278,963 D2990V probably damaging Het
Fbxo18 C T 2: 11,756,685 G597D probably benign Het
Fdxr A C 11: 115,276,854 S12A probably benign Het
Fgf14 T A 14: 124,676,693 R9W possibly damaging Het
Gnat3 A T 5: 17,999,658 D103V Het
Hepacam2 G A 6: 3,487,199 P53S probably benign Het
Jmjd1c A G 10: 67,217,036 T21A probably benign Het
Lama1 T C 17: 67,767,018 C930R Het
Lrp1b T C 2: 40,598,466 T4536A Het
Lrrc27 T A 7: 139,223,658 V166E probably damaging Het
Mapk10 C T 5: 103,038,577 V90I probably benign Het
Mfsd14b C T 13: 65,072,023 G339D probably damaging Het
Mkl2 G T 16: 13,400,976 Q495H probably benign Het
Mnt T A 11: 74,843,283 M580K unknown Het
Mrc1 T C 2: 14,248,869 S234P probably damaging Het
Mrps5 G A 2: 127,591,891 V75I not run Het
Myo10 A G 15: 25,807,827 D1845G probably damaging Het
Olfr147 T C 9: 38,403,353 S160P possibly damaging Het
Olfr19 C A 16: 16,673,166 A272S possibly damaging Het
Olfr402 A T 11: 74,155,846 I231F probably damaging Het
Olfr559 A T 7: 102,723,821 M223K probably benign Het
Pdhx G A 2: 103,046,779 T95M probably damaging Het
Pigb C T 9: 73,038,675 V72I probably damaging Het
Prr7 C A 13: 55,472,353 P110Q unknown Het
Psg22 A G 7: 18,724,404 D340G probably benign Het
Ptprn2 T C 12: 117,248,681 S908P probably benign Het
Ros1 T C 10: 52,118,203 Y1348C probably damaging Het
Rspry1 T C 8: 94,650,335 I506T probably benign Het
Ryr2 T A 13: 11,705,710 Y2684F probably benign Het
Sdr16c6 A G 4: 4,076,575 probably null Het
Senp7 A G 16: 56,173,182 T743A possibly damaging Het
Slc6a20b T C 9: 123,604,949 I275V probably benign Het
Slc6a7 A G 18: 61,001,602 I467T probably benign Het
Tacc2 A G 7: 130,624,633 D1016G probably benign Het
Thsd7a A G 6: 12,554,934 V317A Het
Tle3 A G 9: 61,413,084 H598R probably damaging Het
Tmem102 A G 11: 69,804,123 L341P probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Trhde T A 10: 114,413,263 D866V probably damaging Het
Ttn A G 2: 76,751,273 I23092T probably damaging Het
U2surp C A 9: 95,462,824 V944L unknown Het
Vps45 T A 3: 96,048,387 Y97F probably benign Het
Zc3h12c T C 9: 52,144,102 T136A probably benign Het
Zfp948 A T 17: 21,588,415 H623L probably damaging Het
Other mutations in Urgcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Urgcp APN 11 5716448 missense possibly damaging 0.94
IGL01832:Urgcp APN 11 5717325 missense probably damaging 0.99
IGL02299:Urgcp APN 11 5717573 missense probably damaging 1.00
IGL02519:Urgcp APN 11 5717745 missense probably benign 0.02
IGL02616:Urgcp APN 11 5717400 missense probably damaging 0.99
IGL02619:Urgcp APN 11 5715752 missense possibly damaging 0.87
IGL03135:Urgcp APN 11 5716091 missense possibly damaging 0.79
IGL03209:Urgcp APN 11 5717238 unclassified probably null
PIT4305001:Urgcp UTSW 11 5717996 missense probably damaging 1.00
R0279:Urgcp UTSW 11 5716989 missense probably benign 0.14
R0555:Urgcp UTSW 11 5717477 missense probably damaging 1.00
R1110:Urgcp UTSW 11 5716004 missense probably benign 0.09
R1595:Urgcp UTSW 11 5717447 missense probably damaging 1.00
R1808:Urgcp UTSW 11 5717242 missense probably damaging 1.00
R1891:Urgcp UTSW 11 5716910 missense probably benign 0.43
R1993:Urgcp UTSW 11 5716526 missense probably damaging 1.00
R3155:Urgcp UTSW 11 5716327 missense probably damaging 1.00
R3769:Urgcp UTSW 11 5717000 missense probably damaging 1.00
R4209:Urgcp UTSW 11 5715878 missense probably damaging 0.99
R4210:Urgcp UTSW 11 5715878 missense probably damaging 0.99
R4211:Urgcp UTSW 11 5715878 missense probably damaging 0.99
R5335:Urgcp UTSW 11 5717754 missense possibly damaging 0.66
R6242:Urgcp UTSW 11 5716691 missense probably benign 0.34
R6971:Urgcp UTSW 11 5718115 missense probably benign 0.34
R7411:Urgcp UTSW 11 5718116 missense probably benign 0.10
R7734:Urgcp UTSW 11 5716406 missense probably benign 0.00
R7809:Urgcp UTSW 11 5723133 missense probably benign 0.02
X0005:Urgcp UTSW 11 5718231 missense probably damaging 1.00
Z1176:Urgcp UTSW 11 5717103 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTATGCAGCTCCTTGAGAAG -3'
(R):5'- CATCCTGGGAATAAGCAGCC -3'

Sequencing Primer
(F):5'- TCCTTGAGAAGCCCAGTGAC -3'
(R):5'- TGGGAATAAGCAGCCCCTCC -3'
Posted On2019-10-07