Incidental Mutation 'R7460:Mnt'
ID578406
Institutional Source Beutler Lab
Gene Symbol Mnt
Ensembl Gene ENSMUSG00000000282
Gene Namemax binding protein
SynonymsbHLHd3, Rox
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R7460 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location74830920-74845725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74843283 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 580 (M580K)
Ref Sequence ENSEMBL: ENSMUSP00000000291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000291] [ENSMUST00000132150]
Predicted Effect unknown
Transcript: ENSMUST00000000291
AA Change: M580K
SMART Domains Protein: ENSMUSP00000000291
Gene: ENSMUSG00000000282
AA Change: M580K

DomainStartEndE-ValueType
coiled coil region 3 53 N/A INTRINSIC
low complexity region 64 88 N/A INTRINSIC
low complexity region 100 125 N/A INTRINSIC
low complexity region 182 205 N/A INTRINSIC
HLH 228 279 2.99e-13 SMART
low complexity region 368 431 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 515 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132150
SMART Domains Protein: ENSMUSP00000118435
Gene: ENSMUSG00000000282

DomainStartEndE-ValueType
HLH 1 47 2.92e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Myc/Max/Mad network comprises a group of transcription factors that co-interact to regulate gene-specific transcriptional activation or repression. This gene encodes a protein member of the Myc/Max/Mad network. This protein has a basic-Helix-Loop-Helix-zipper domain (bHLHzip) with which it binds the canonical DNA sequence CANNTG, known as the E box, following heterodimerization with Max proteins. This protein is likely a transcriptional repressor and an antagonist of Myc-dependent transcriptional activation and cell growth. This protein represses transcription by binding to DNA binding proteins at its N-terminal Sin3-interaction domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygotes for a targeted null mutation are runted at birth and die within a few days, while mutant fibroblasts show abnormal cell cycling. Those homozygotes that survive are fertile and attain normal Heterozygotes for a conditional mammary epithelial specific knockout develop adenocarcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,254,648 N625D probably benign Het
Abi2 T A 1: 60,434,307 V61D probably damaging Het
Agrn C A 4: 156,174,424 V915L probably damaging Het
Arhgap24 T C 5: 102,892,346 V476A probably benign Het
Arhgef15 A G 11: 68,947,035 L720P probably damaging Het
Atad2b C A 12: 4,952,660 R343S probably benign Het
Atxn3 T A 12: 101,926,517 T313S probably benign Het
BC037034 G A 5: 138,262,729 T218M probably benign Het
BC051665 T C 13: 60,784,643 E76G probably benign Het
Birc2 A T 9: 7,818,761 F610I probably damaging Het
Cdh16 A T 8: 104,622,291 V58D possibly damaging Het
Cenpf T C 1: 189,654,050 D2011G probably damaging Het
Ddb1 T C 19: 10,607,911 probably null Het
Ddx1 A G 12: 13,231,439 probably null Het
Disp2 A G 2: 118,789,780 H331R probably damaging Het
Dmxl1 A G 18: 49,878,612 T1279A probably benign Het
Dync1i2 T C 2: 71,250,886 I473T probably damaging Het
Fam114a1 T G 5: 65,038,707 V520G possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat2 T A 11: 55,278,963 D2990V probably damaging Het
Fbxo18 C T 2: 11,756,685 G597D probably benign Het
Fdxr A C 11: 115,276,854 S12A probably benign Het
Fgf14 T A 14: 124,676,693 R9W possibly damaging Het
Gnat3 A T 5: 17,999,658 D103V Het
Hepacam2 G A 6: 3,487,199 P53S probably benign Het
Jmjd1c A G 10: 67,217,036 T21A probably benign Het
Lama1 T C 17: 67,767,018 C930R Het
Lrp1b T C 2: 40,598,466 T4536A Het
Lrrc27 T A 7: 139,223,658 V166E probably damaging Het
Mapk10 C T 5: 103,038,577 V90I probably benign Het
Mfsd14b C T 13: 65,072,023 G339D probably damaging Het
Mkl2 G T 16: 13,400,976 Q495H probably benign Het
Mrc1 T C 2: 14,248,869 S234P probably damaging Het
Mrps5 G A 2: 127,591,891 V75I not run Het
Myo10 A G 15: 25,807,827 D1845G probably damaging Het
Olfr147 T C 9: 38,403,353 S160P possibly damaging Het
Olfr19 C A 16: 16,673,166 A272S possibly damaging Het
Olfr402 A T 11: 74,155,846 I231F probably damaging Het
Olfr559 A T 7: 102,723,821 M223K probably benign Het
Pdhx G A 2: 103,046,779 T95M probably damaging Het
Pigb C T 9: 73,038,675 V72I probably damaging Het
Prr7 C A 13: 55,472,353 P110Q unknown Het
Psg22 A G 7: 18,724,404 D340G probably benign Het
Ptprn2 T C 12: 117,248,681 S908P probably benign Het
Ros1 T C 10: 52,118,203 Y1348C probably damaging Het
Rspry1 T C 8: 94,650,335 I506T probably benign Het
Ryr2 T A 13: 11,705,710 Y2684F probably benign Het
Sdr16c6 A G 4: 4,076,575 probably null Het
Senp7 A G 16: 56,173,182 T743A possibly damaging Het
Slc6a20b T C 9: 123,604,949 I275V probably benign Het
Slc6a7 A G 18: 61,001,602 I467T probably benign Het
Tacc2 A G 7: 130,624,633 D1016G probably benign Het
Thsd7a A G 6: 12,554,934 V317A Het
Tle3 A G 9: 61,413,084 H598R probably damaging Het
Tmem102 A G 11: 69,804,123 L341P probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Trhde T A 10: 114,413,263 D866V probably damaging Het
Ttn A G 2: 76,751,273 I23092T probably damaging Het
U2surp C A 9: 95,462,824 V944L unknown Het
Urgcp T C 11: 5,716,622 H615R possibly damaging Het
Vps45 T A 3: 96,048,387 Y97F probably benign Het
Zc3h12c T C 9: 52,144,102 T136A probably benign Het
Zfp948 A T 17: 21,588,415 H623L probably damaging Het
Other mutations in Mnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Mnt APN 11 74842185 missense probably damaging 1.00
R0599:Mnt UTSW 11 74842296 missense probably benign 0.09
R2100:Mnt UTSW 11 74831351 missense probably damaging 1.00
R3076:Mnt UTSW 11 74843110 intron probably benign
R3077:Mnt UTSW 11 74843110 intron probably benign
R3078:Mnt UTSW 11 74843110 intron probably benign
R3605:Mnt UTSW 11 74836920 missense possibly damaging 0.89
R4601:Mnt UTSW 11 74836459 missense possibly damaging 0.76
R5766:Mnt UTSW 11 74843078 intron probably benign
R6340:Mnt UTSW 11 74836416 missense probably damaging 1.00
R6988:Mnt UTSW 11 74842809 intron probably benign
Z1176:Mnt UTSW 11 74836675 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAACCATGTTCTGCAGG -3'
(R):5'- AAAAGCATCCTCCTGTCTGCC -3'

Sequencing Primer
(F):5'- AACCATGTGGCCCACCTTG -3'
(R):5'- TGGCTCAGAGTCTCTGCAC -3'
Posted On2019-10-07