Incidental Mutation 'R7460:Fdxr'
ID578407
Institutional Source Beutler Lab
Gene Symbol Fdxr
Ensembl Gene ENSMUSG00000018861
Gene Nameferredoxin reductase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R7460 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location115268024-115277050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 115276854 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 12 (S12A)
Ref Sequence ENSEMBL: ENSMUSP00000021078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021078] [ENSMUST00000056153]
Predicted Effect probably benign
Transcript: ENSMUST00000021078
AA Change: S12A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021078
Gene: ENSMUSG00000018861
AA Change: S12A

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:Pyr_redox_2 41 246 2.9e-10 PFAM
low complexity region 273 286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056153
SMART Domains Protein: ENSMUSP00000058783
Gene: ENSMUSG00000044788

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Pfam:FA_desaturase 62 313 3.2e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial flavoprotein that initiates electron transport for cytochromes P450 receiving electrons from NADPH. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,254,648 N625D probably benign Het
Abi2 T A 1: 60,434,307 V61D probably damaging Het
Agrn C A 4: 156,174,424 V915L probably damaging Het
Arhgap24 T C 5: 102,892,346 V476A probably benign Het
Arhgef15 A G 11: 68,947,035 L720P probably damaging Het
Atad2b C A 12: 4,952,660 R343S probably benign Het
Atxn3 T A 12: 101,926,517 T313S probably benign Het
BC037034 G A 5: 138,262,729 T218M probably benign Het
BC051665 T C 13: 60,784,643 E76G probably benign Het
Birc2 A T 9: 7,818,761 F610I probably damaging Het
Cdh16 A T 8: 104,622,291 V58D possibly damaging Het
Cenpf T C 1: 189,654,050 D2011G probably damaging Het
Ddb1 T C 19: 10,607,911 probably null Het
Ddx1 A G 12: 13,231,439 probably null Het
Disp2 A G 2: 118,789,780 H331R probably damaging Het
Dmxl1 A G 18: 49,878,612 T1279A probably benign Het
Dync1i2 T C 2: 71,250,886 I473T probably damaging Het
Fam114a1 T G 5: 65,038,707 V520G possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat2 T A 11: 55,278,963 D2990V probably damaging Het
Fbxo18 C T 2: 11,756,685 G597D probably benign Het
Fgf14 T A 14: 124,676,693 R9W possibly damaging Het
Gnat3 A T 5: 17,999,658 D103V Het
Hepacam2 G A 6: 3,487,199 P53S probably benign Het
Jmjd1c A G 10: 67,217,036 T21A probably benign Het
Lama1 T C 17: 67,767,018 C930R Het
Lrp1b T C 2: 40,598,466 T4536A Het
Lrrc27 T A 7: 139,223,658 V166E probably damaging Het
Mapk10 C T 5: 103,038,577 V90I probably benign Het
Mfsd14b C T 13: 65,072,023 G339D probably damaging Het
Mkl2 G T 16: 13,400,976 Q495H probably benign Het
Mnt T A 11: 74,843,283 M580K unknown Het
Mrc1 T C 2: 14,248,869 S234P probably damaging Het
Mrps5 G A 2: 127,591,891 V75I not run Het
Myo10 A G 15: 25,807,827 D1845G probably damaging Het
Olfr147 T C 9: 38,403,353 S160P possibly damaging Het
Olfr19 C A 16: 16,673,166 A272S possibly damaging Het
Olfr402 A T 11: 74,155,846 I231F probably damaging Het
Olfr559 A T 7: 102,723,821 M223K probably benign Het
Pdhx G A 2: 103,046,779 T95M probably damaging Het
Pigb C T 9: 73,038,675 V72I probably damaging Het
Prr7 C A 13: 55,472,353 P110Q unknown Het
Psg22 A G 7: 18,724,404 D340G probably benign Het
Ptprn2 T C 12: 117,248,681 S908P probably benign Het
Ros1 T C 10: 52,118,203 Y1348C probably damaging Het
Rspry1 T C 8: 94,650,335 I506T probably benign Het
Ryr2 T A 13: 11,705,710 Y2684F probably benign Het
Sdr16c6 A G 4: 4,076,575 probably null Het
Senp7 A G 16: 56,173,182 T743A possibly damaging Het
Slc6a20b T C 9: 123,604,949 I275V probably benign Het
Slc6a7 A G 18: 61,001,602 I467T probably benign Het
Tacc2 A G 7: 130,624,633 D1016G probably benign Het
Thsd7a A G 6: 12,554,934 V317A Het
Tle3 A G 9: 61,413,084 H598R probably damaging Het
Tmem102 A G 11: 69,804,123 L341P probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Trhde T A 10: 114,413,263 D866V probably damaging Het
Ttn A G 2: 76,751,273 I23092T probably damaging Het
U2surp C A 9: 95,462,824 V944L unknown Het
Urgcp T C 11: 5,716,622 H615R possibly damaging Het
Vps45 T A 3: 96,048,387 Y97F probably benign Het
Zc3h12c T C 9: 52,144,102 T136A probably benign Het
Zfp948 A T 17: 21,588,415 H623L probably damaging Het
Other mutations in Fdxr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Fdxr APN 11 115269576 missense probably benign
IGL02524:Fdxr APN 11 115271260 critical splice donor site probably null
IGL03195:Fdxr APN 11 115276092 missense probably benign 0.29
R0371:Fdxr UTSW 11 115276089 missense possibly damaging 0.66
R0749:Fdxr UTSW 11 115276845 missense probably benign
R1165:Fdxr UTSW 11 115271782 unclassified probably benign
R1819:Fdxr UTSW 11 115276104 missense probably damaging 0.96
R2201:Fdxr UTSW 11 115270382 missense probably benign 0.41
R2507:Fdxr UTSW 11 115271980 missense probably damaging 0.98
R2508:Fdxr UTSW 11 115271980 missense probably damaging 0.98
R3701:Fdxr UTSW 11 115269701 missense probably damaging 0.99
R5004:Fdxr UTSW 11 115269573 missense probably benign 0.05
R5333:Fdxr UTSW 11 115272258 missense probably benign 0.13
R5944:Fdxr UTSW 11 115269846 missense probably benign
R7124:Fdxr UTSW 11 115269577 missense probably benign 0.00
R7780:Fdxr UTSW 11 115276830 missense probably benign 0.00
R8053:Fdxr UTSW 11 115269839 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGGACGCCTTACATCTCTTTG -3'
(R):5'- TTTCTAAGCAAGCGGGAGGC -3'

Sequencing Primer
(F):5'- GACGCCTTACATCTCTTTGCACAG -3'
(R):5'- GGGAGGCGAGGCTTGGG -3'
Posted On2019-10-07