Mutagenetix > Incidental Mutation

Incidental Mutation 'R7460:Ptprn2'

578411

Institutional Source

Beutler Lab

Gene Symbol

Ptprn2

Ensembl Gene

ENSMUSG00000056553

Gene Name

protein tyrosine phosphatase, receptor type, N polypeptide 2

Synonyms

phogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.168) question?

Stock #

R7460 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

116485720-117276849 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 117248681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 908 (S908P)

Ref Sequence

ENSEMBL: ENSMUSP00000064046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]

AlphaFold

P80560

Predicted Effect

probably benign
Transcript: ENSMUST00000070733
AA Change: S908P

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: S908P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	495	583	1.5e-35	PFAM
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	993	4.42e-119	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190247
AA Change: S908P

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: S908P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	494	584	2.5e-43	PFAM
transmembrane domain	602	624	N/A	INTRINSIC
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	932	8.81e-64	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	T	C	9: 103,254,648	N625D	probably benign	Het
Abi2	T	A	1: 60,434,307	V61D	probably damaging	Het
Agrn	C	A	4: 156,174,424	V915L	probably damaging	Het
Arhgap24	T	C	5: 102,892,346	V476A	probably benign	Het
Arhgef15	A	G	11: 68,947,035	L720P	probably damaging	Het
Atad2b	C	A	12: 4,952,660	R343S	probably benign	Het
Atxn3	T	A	12: 101,926,517	T313S	probably benign	Het
BC037034	G	A	5: 138,262,729	T218M	probably benign	Het
BC051665	T	C	13: 60,784,643	E76G	probably benign	Het
Birc2	A	T	9: 7,818,761	F610I	probably damaging	Het
Cdh16	A	T	8: 104,622,291	V58D	possibly damaging	Het
Cenpf	T	C	1: 189,654,050	D2011G	probably damaging	Het
Ddb1	T	C	19: 10,607,911		probably null	Het
Ddx1	A	G	12: 13,231,439		probably null	Het
Disp2	A	G	2: 118,789,780	H331R	probably damaging	Het
Dmxl1	A	G	18: 49,878,612	T1279A	probably benign	Het
Dync1i2	T	C	2: 71,250,886	I473T	probably damaging	Het
Fam114a1	T	G	5: 65,038,707	V520G	possibly damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fat2	T	A	11: 55,278,963	D2990V	probably damaging	Het
Fbxo18	C	T	2: 11,756,685	G597D	probably benign	Het
Fdxr	A	C	11: 115,276,854	S12A	probably benign	Het
Fgf14	T	A	14: 124,676,693	R9W	possibly damaging	Het
Gnat3	A	T	5: 17,999,658	D103V		Het
Hepacam2	G	A	6: 3,487,199	P53S	probably benign	Het
Jmjd1c	A	G	10: 67,217,036	T21A	probably benign	Het
Lama1	T	C	17: 67,767,018	C930R		Het
Lrp1b	T	C	2: 40,598,466	T4536A		Het
Lrrc27	T	A	7: 139,223,658	V166E	probably damaging	Het
Mapk10	C	T	5: 103,038,577	V90I	probably benign	Het
Mfsd14b	C	T	13: 65,072,023	G339D	probably damaging	Het
Mkl2	G	T	16: 13,400,976	Q495H	probably benign	Het
Mnt	T	A	11: 74,843,283	M580K	unknown	Het
Mrc1	T	C	2: 14,248,869	S234P	probably damaging	Het
Mrps5	G	A	2: 127,591,891	V75I	not run	Het
Myo10	A	G	15: 25,807,827	D1845G	probably damaging	Het
Olfr147	T	C	9: 38,403,353	S160P	possibly damaging	Het
Olfr19	C	A	16: 16,673,166	A272S	possibly damaging	Het
Olfr402	A	T	11: 74,155,846	I231F	probably damaging	Het
Olfr559	A	T	7: 102,723,821	M223K	probably benign	Het
Pdhx	G	A	2: 103,046,779	T95M	probably damaging	Het
Pigb	C	T	9: 73,038,675	V72I	probably damaging	Het
Prr7	C	A	13: 55,472,353	P110Q	unknown	Het
Psg22	A	G	7: 18,724,404	D340G	probably benign	Het
Ros1	T	C	10: 52,118,203	Y1348C	probably damaging	Het
Rspry1	T	C	8: 94,650,335	I506T	probably benign	Het
Ryr2	T	A	13: 11,705,710	Y2684F	probably benign	Het
Sdr16c6	A	G	4: 4,076,575		probably null	Het
Senp7	A	G	16: 56,173,182	T743A	possibly damaging	Het
Slc6a20b	T	C	9: 123,604,949	I275V	probably benign	Het
Slc6a7	A	G	18: 61,001,602	I467T	probably benign	Het
Tacc2	A	G	7: 130,624,633	D1016G	probably benign	Het
Thsd7a	A	G	6: 12,554,934	V317A		Het
Tle3	A	G	9: 61,413,084	H598R	probably damaging	Het
Tmem102	A	G	11: 69,804,123	L341P	probably damaging	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Trhde	T	A	10: 114,413,263	D866V	probably damaging	Het
Ttn	A	G	2: 76,751,273	I23092T	probably damaging	Het
U2surp	C	A	9: 95,462,824	V944L	unknown	Het
Urgcp	T	C	11: 5,716,622	H615R	possibly damaging	Het
Vps45	T	A	3: 96,048,387	Y97F	probably benign	Het
Zc3h12c	T	C	9: 52,144,102	T136A	probably benign	Het
Zfp948	A	T	17: 21,588,415	H623L	probably damaging	Het

Other mutations in Ptprn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01695:Ptprn2	APN	12	116841388	missense	probably benign	0.02
IGL01788:Ptprn2	APN	12	116900987	missense	probably damaging	0.98
IGL02172:Ptprn2	APN	12	116873697	splice site	probably benign
IGL02339:Ptprn2	APN	12	116722104	missense	probably damaging	1.00
IGL02706:Ptprn2	APN	12	116888898	missense	probably damaging	0.96
IGL03018:Ptprn2	APN	12	117211943	missense	probably damaging	1.00
IGL03267:Ptprn2	APN	12	116876344	nonsense	probably null
BB001:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
BB011:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
IGL03014:Ptprn2	UTSW	12	117248688	missense	probably damaging	1.00
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0115:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0132:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0481:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0694:Ptprn2	UTSW	12	116824355	missense	possibly damaging	0.69
R0698:Ptprn2	UTSW	12	116722130	nonsense	probably null
R0746:Ptprn2	UTSW	12	116901017	missense	probably benign	0.00
R1127:Ptprn2	UTSW	12	117212008	splice site	probably null
R1443:Ptprn2	UTSW	12	117253615	missense	probably damaging	1.00
R1508:Ptprn2	UTSW	12	117184722	missense	probably damaging	1.00
R1664:Ptprn2	UTSW	12	117161709	missense	probably damaging	0.99
R1670:Ptprn2	UTSW	12	116722172	missense	possibly damaging	0.64
R1749:Ptprn2	UTSW	12	116580428	missense	probably benign	0.00
R2075:Ptprn2	UTSW	12	117247717	missense	probably benign	0.01
R3054:Ptprn2	UTSW	12	116722133	missense	probably damaging	1.00
R3107:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3109:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3552:Ptprn2	UTSW	12	116888877	missense	probably benign	0.00
R4193:Ptprn2	UTSW	12	116901008	missense	probably benign	0.01
R4523:Ptprn2	UTSW	12	116876000	missense	probably damaging	1.00
R4706:Ptprn2	UTSW	12	116872094	missense	probably benign	0.02
R4719:Ptprn2	UTSW	12	116824396	missense	possibly damaging	0.95
R4726:Ptprn2	UTSW	12	117247773	nonsense	probably null
R4872:Ptprn2	UTSW	12	117161694	missense	probably damaging	1.00
R4891:Ptprn2	UTSW	12	117233365	splice site	probably null
R4970:Ptprn2	UTSW	12	117276595	missense	probably damaging	1.00
R5208:Ptprn2	UTSW	12	116858928	missense	probably damaging	1.00
R5287:Ptprn2	UTSW	12	117211862	missense	probably damaging	1.00
R5419:Ptprn2	UTSW	12	117184647	missense	probably damaging	0.99
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6180:Ptprn2	UTSW	12	116859119	missense	probably benign	0.05
R6277:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R6465:Ptprn2	UTSW	12	117269589	missense	probably damaging	0.96
R6488:Ptprn2	UTSW	12	116872038	missense	probably benign	0.13
R6555:Ptprn2	UTSW	12	117227200	missense	probably damaging	1.00
R6908:Ptprn2	UTSW	12	116888888	missense	probably benign	0.06
R7120:Ptprn2	UTSW	12	116872056	missense	probably benign	0.01
R7229:Ptprn2	UTSW	12	117227225	splice site	probably null
R7237:Ptprn2	UTSW	12	117161727	missense	probably benign	0.03
R7304:Ptprn2	UTSW	12	117248544	missense	probably damaging	1.00
R7355:Ptprn2	UTSW	12	116858951	missense	probably benign
R7577:Ptprn2	UTSW	12	116485866	start codon destroyed	probably null
R7658:Ptprn2	UTSW	12	116722119	missense	probably benign	0.01
R7666:Ptprn2	UTSW	12	116841320	missense	probably benign	0.10
R7924:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
R8219:Ptprn2	UTSW	12	117184737	missense	probably benign	0.30
R8716:Ptprn2	UTSW	12	117255548	missense	possibly damaging	0.73
R9235:Ptprn2	UTSW	12	117269651	critical splice donor site	probably null
R9605:Ptprn2	UTSW	12	117161658	missense	probably benign	0.13
X0066:Ptprn2	UTSW	12	117161760	missense	probably damaging	1.00
X0066:Ptprn2	UTSW	12	117184740	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- TGCTAATCTGTCCCCACCAG -3'
(R):5'- ACCTGCAGAGCTCTACGATG -3'

Sequencing Primer
(F):5'- AGGTCAATCTAGTCTCTGAGCAC -3'
(R):5'- CACCTTTATCTGATGGACTGATGGAC -3'

Posted On

2019-10-07