Incidental Mutation 'R7460:Mfsd14b'
ID578415
Institutional Source Beutler Lab
Gene Symbol Mfsd14b
Ensembl Gene ENSMUSG00000038212
Gene Namemajor facilitator superfamily domain containing 14B
Synonyms5730414C17Rik, Hiatl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R7460 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location65064663-65112975 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65072023 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 339 (G339D)
Ref Sequence ENSEMBL: ENSMUSP00000118180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054730] [ENSMUST00000155487]
Predicted Effect probably damaging
Transcript: ENSMUST00000054730
AA Change: G339D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062566
Gene: ENSMUSG00000038212
AA Change: G339D

DomainStartEndE-ValueType
Pfam:MFS_1 50 396 4.5e-33 PFAM
transmembrane domain 428 450 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155487
AA Change: G339D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118180
Gene: ENSMUSG00000038212
AA Change: G339D

DomainStartEndE-ValueType
Pfam:MFS_1 50 396 4.6e-33 PFAM
transmembrane domain 428 450 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,254,648 N625D probably benign Het
Abi2 T A 1: 60,434,307 V61D probably damaging Het
Agrn C A 4: 156,174,424 V915L probably damaging Het
Arhgap24 T C 5: 102,892,346 V476A probably benign Het
Arhgef15 A G 11: 68,947,035 L720P probably damaging Het
Atad2b C A 12: 4,952,660 R343S probably benign Het
Atxn3 T A 12: 101,926,517 T313S probably benign Het
BC037034 G A 5: 138,262,729 T218M probably benign Het
BC051665 T C 13: 60,784,643 E76G probably benign Het
Birc2 A T 9: 7,818,761 F610I probably damaging Het
Cdh16 A T 8: 104,622,291 V58D possibly damaging Het
Cenpf T C 1: 189,654,050 D2011G probably damaging Het
Ddb1 T C 19: 10,607,911 probably null Het
Ddx1 A G 12: 13,231,439 probably null Het
Disp2 A G 2: 118,789,780 H331R probably damaging Het
Dmxl1 A G 18: 49,878,612 T1279A probably benign Het
Dync1i2 T C 2: 71,250,886 I473T probably damaging Het
Fam114a1 T G 5: 65,038,707 V520G possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat2 T A 11: 55,278,963 D2990V probably damaging Het
Fbxo18 C T 2: 11,756,685 G597D probably benign Het
Fdxr A C 11: 115,276,854 S12A probably benign Het
Fgf14 T A 14: 124,676,693 R9W possibly damaging Het
Gnat3 A T 5: 17,999,658 D103V Het
Hepacam2 G A 6: 3,487,199 P53S probably benign Het
Jmjd1c A G 10: 67,217,036 T21A probably benign Het
Lama1 T C 17: 67,767,018 C930R Het
Lrp1b T C 2: 40,598,466 T4536A Het
Lrrc27 T A 7: 139,223,658 V166E probably damaging Het
Mapk10 C T 5: 103,038,577 V90I probably benign Het
Mkl2 G T 16: 13,400,976 Q495H probably benign Het
Mnt T A 11: 74,843,283 M580K unknown Het
Mrc1 T C 2: 14,248,869 S234P probably damaging Het
Mrps5 G A 2: 127,591,891 V75I not run Het
Myo10 A G 15: 25,807,827 D1845G probably damaging Het
Olfr147 T C 9: 38,403,353 S160P possibly damaging Het
Olfr19 C A 16: 16,673,166 A272S possibly damaging Het
Olfr402 A T 11: 74,155,846 I231F probably damaging Het
Olfr559 A T 7: 102,723,821 M223K probably benign Het
Pdhx G A 2: 103,046,779 T95M probably damaging Het
Pigb C T 9: 73,038,675 V72I probably damaging Het
Prr7 C A 13: 55,472,353 P110Q unknown Het
Psg22 A G 7: 18,724,404 D340G probably benign Het
Ptprn2 T C 12: 117,248,681 S908P probably benign Het
Ros1 T C 10: 52,118,203 Y1348C probably damaging Het
Rspry1 T C 8: 94,650,335 I506T probably benign Het
Ryr2 T A 13: 11,705,710 Y2684F probably benign Het
Sdr16c6 A G 4: 4,076,575 probably null Het
Senp7 A G 16: 56,173,182 T743A possibly damaging Het
Slc6a20b T C 9: 123,604,949 I275V probably benign Het
Slc6a7 A G 18: 61,001,602 I467T probably benign Het
Tacc2 A G 7: 130,624,633 D1016G probably benign Het
Thsd7a A G 6: 12,554,934 V317A Het
Tle3 A G 9: 61,413,084 H598R probably damaging Het
Tmem102 A G 11: 69,804,123 L341P probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Trhde T A 10: 114,413,263 D866V probably damaging Het
Ttn A G 2: 76,751,273 I23092T probably damaging Het
U2surp C A 9: 95,462,824 V944L unknown Het
Urgcp T C 11: 5,716,622 H615R possibly damaging Het
Vps45 T A 3: 96,048,387 Y97F probably benign Het
Zc3h12c T C 9: 52,144,102 T136A probably benign Het
Zfp948 A T 17: 21,588,415 H623L probably damaging Het
Other mutations in Mfsd14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Mfsd14b APN 13 65066701 missense probably benign 0.00
IGL01935:Mfsd14b APN 13 65067925 missense probably benign
IGL01957:Mfsd14b APN 13 65087093 missense possibly damaging 0.90
R0555:Mfsd14b UTSW 13 65078445 missense probably benign 0.34
R0601:Mfsd14b UTSW 13 65087150 missense possibly damaging 0.88
R0988:Mfsd14b UTSW 13 65112493 splice site probably benign
R1136:Mfsd14b UTSW 13 65095692 missense probably benign 0.22
R1494:Mfsd14b UTSW 13 65095671 missense probably damaging 1.00
R2087:Mfsd14b UTSW 13 65067982 missense probably damaging 1.00
R4223:Mfsd14b UTSW 13 65066608 utr 3 prime probably benign
R5103:Mfsd14b UTSW 13 65087093 missense possibly damaging 0.56
R5568:Mfsd14b UTSW 13 65072122 splice site probably null
R5603:Mfsd14b UTSW 13 65073606 missense probably benign 0.00
R6181:Mfsd14b UTSW 13 65112584 missense probably benign 0.00
R6330:Mfsd14b UTSW 13 65095686 missense probably damaging 1.00
R6649:Mfsd14b UTSW 13 65066785 missense probably damaging 1.00
R7605:Mfsd14b UTSW 13 65066777 missense probably benign
X0017:Mfsd14b UTSW 13 65072053 missense probably benign 0.08
X0027:Mfsd14b UTSW 13 65072011 missense probably benign 0.16
X0063:Mfsd14b UTSW 13 65078485 intron probably null
Predicted Primers PCR Primer
(F):5'- CTTGCCCAGGGGTAAAATGTTG -3'
(R):5'- GGGATCATAGACTGTCAGTGTCC -3'

Sequencing Primer
(F):5'- TTGCCCAGGGGTAAAATGTTGAATAC -3'
(R):5'- CAGTGTCCTCTTAAAGGTCCAGTGAG -3'
Posted On2019-10-07