Incidental Mutation 'R7460:Dmxl1'
ID578424
Institutional Source Beutler Lab
Gene Symbol Dmxl1
Ensembl Gene ENSMUSG00000037416
Gene NameDmx-like 1
SynonymsC630007L23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R7460 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location49832670-49965473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49878612 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1279 (T1279A)
Ref Sequence ENSEMBL: ENSMUSP00000137871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]
Predicted Effect probably benign
Transcript: ENSMUST00000041772
AA Change: T1279A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: T1279A

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
Pfam:Rav1p_C 1102 1877 4.3e-84 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2371 2385 N/A INTRINSIC
low complexity region 2397 2410 N/A INTRINSIC
low complexity region 2449 2466 N/A INTRINSIC
WD40 2735 2770 1.07e1 SMART
WD40 2773 2813 3.7e0 SMART
WD40 2825 2867 1.07e0 SMART
WD40 2873 2912 1.05e-2 SMART
WD40 2915 2954 4.51e-7 SMART
Blast:WD40 2957 3005 9e-26 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180611
AA Change: T1279A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: T1279A

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
low complexity region 1195 1206 N/A INTRINSIC
low complexity region 1258 1271 N/A INTRINSIC
Pfam:Rav1p_C 1287 1876 9.4e-72 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2385 2398 N/A INTRINSIC
low complexity region 2437 2454 N/A INTRINSIC
WD40 2723 2758 1.07e1 SMART
WD40 2761 2801 3.7e0 SMART
WD40 2813 2855 1.07e0 SMART
WD40 2861 2900 1.05e-2 SMART
WD40 2903 2942 4.51e-7 SMART
Blast:WD40 2945 2993 9e-26 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,254,648 N625D probably benign Het
Abi2 T A 1: 60,434,307 V61D probably damaging Het
Agrn C A 4: 156,174,424 V915L probably damaging Het
Arhgap24 T C 5: 102,892,346 V476A probably benign Het
Arhgef15 A G 11: 68,947,035 L720P probably damaging Het
Atad2b C A 12: 4,952,660 R343S probably benign Het
Atxn3 T A 12: 101,926,517 T313S probably benign Het
BC037034 G A 5: 138,262,729 T218M probably benign Het
BC051665 T C 13: 60,784,643 E76G probably benign Het
Birc2 A T 9: 7,818,761 F610I probably damaging Het
Cdh16 A T 8: 104,622,291 V58D possibly damaging Het
Cenpf T C 1: 189,654,050 D2011G probably damaging Het
Ddb1 T C 19: 10,607,911 probably null Het
Ddx1 A G 12: 13,231,439 probably null Het
Disp2 A G 2: 118,789,780 H331R probably damaging Het
Dync1i2 T C 2: 71,250,886 I473T probably damaging Het
Fam114a1 T G 5: 65,038,707 V520G possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat2 T A 11: 55,278,963 D2990V probably damaging Het
Fbxo18 C T 2: 11,756,685 G597D probably benign Het
Fdxr A C 11: 115,276,854 S12A probably benign Het
Fgf14 T A 14: 124,676,693 R9W possibly damaging Het
Gnat3 A T 5: 17,999,658 D103V Het
Hepacam2 G A 6: 3,487,199 P53S probably benign Het
Jmjd1c A G 10: 67,217,036 T21A probably benign Het
Lama1 T C 17: 67,767,018 C930R Het
Lrp1b T C 2: 40,598,466 T4536A Het
Lrrc27 T A 7: 139,223,658 V166E probably damaging Het
Mapk10 C T 5: 103,038,577 V90I probably benign Het
Mfsd14b C T 13: 65,072,023 G339D probably damaging Het
Mkl2 G T 16: 13,400,976 Q495H probably benign Het
Mnt T A 11: 74,843,283 M580K unknown Het
Mrc1 T C 2: 14,248,869 S234P probably damaging Het
Mrps5 G A 2: 127,591,891 V75I not run Het
Myo10 A G 15: 25,807,827 D1845G probably damaging Het
Olfr147 T C 9: 38,403,353 S160P possibly damaging Het
Olfr19 C A 16: 16,673,166 A272S possibly damaging Het
Olfr402 A T 11: 74,155,846 I231F probably damaging Het
Olfr559 A T 7: 102,723,821 M223K probably benign Het
Pdhx G A 2: 103,046,779 T95M probably damaging Het
Pigb C T 9: 73,038,675 V72I probably damaging Het
Prr7 C A 13: 55,472,353 P110Q unknown Het
Psg22 A G 7: 18,724,404 D340G probably benign Het
Ptprn2 T C 12: 117,248,681 S908P probably benign Het
Ros1 T C 10: 52,118,203 Y1348C probably damaging Het
Rspry1 T C 8: 94,650,335 I506T probably benign Het
Ryr2 T A 13: 11,705,710 Y2684F probably benign Het
Sdr16c6 A G 4: 4,076,575 probably null Het
Senp7 A G 16: 56,173,182 T743A possibly damaging Het
Slc6a20b T C 9: 123,604,949 I275V probably benign Het
Slc6a7 A G 18: 61,001,602 I467T probably benign Het
Tacc2 A G 7: 130,624,633 D1016G probably benign Het
Thsd7a A G 6: 12,554,934 V317A Het
Tle3 A G 9: 61,413,084 H598R probably damaging Het
Tmem102 A G 11: 69,804,123 L341P probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Trhde T A 10: 114,413,263 D866V probably damaging Het
Ttn A G 2: 76,751,273 I23092T probably damaging Het
U2surp C A 9: 95,462,824 V944L unknown Het
Urgcp T C 11: 5,716,622 H615R possibly damaging Het
Vps45 T A 3: 96,048,387 Y97F probably benign Het
Zc3h12c T C 9: 52,144,102 T136A probably benign Het
Zfp948 A T 17: 21,588,415 H623L probably damaging Het
Other mutations in Dmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Dmxl1 APN 18 49851467 missense probably damaging 1.00
IGL00668:Dmxl1 APN 18 49939553 missense possibly damaging 0.64
IGL00740:Dmxl1 APN 18 49917668 missense probably benign 0.00
IGL00969:Dmxl1 APN 18 49912725 missense probably benign 0.02
IGL01113:Dmxl1 APN 18 49912751 missense probably benign 0.01
IGL01384:Dmxl1 APN 18 49857334 missense probably benign
IGL01475:Dmxl1 APN 18 49871714 missense probably damaging 1.00
IGL01559:Dmxl1 APN 18 49920938 missense probably damaging 0.99
IGL01578:Dmxl1 APN 18 49962205 missense probably damaging 1.00
IGL01632:Dmxl1 APN 18 49863025 missense probably damaging 0.99
IGL01814:Dmxl1 APN 18 49864868 missense probably damaging 1.00
IGL01843:Dmxl1 APN 18 49878382 nonsense probably null
IGL01933:Dmxl1 APN 18 49877785 missense probably benign 0.17
IGL01952:Dmxl1 APN 18 49890654 missense probably benign 0.11
IGL02120:Dmxl1 APN 18 49894178 missense possibly damaging 0.83
IGL02162:Dmxl1 APN 18 49961163 missense probably benign 0.00
IGL02213:Dmxl1 APN 18 49877674 splice site probably benign
IGL02261:Dmxl1 APN 18 49840499 missense possibly damaging 0.85
IGL02689:Dmxl1 APN 18 49864895 missense probably damaging 1.00
IGL02892:Dmxl1 APN 18 49859120 missense probably damaging 0.96
IGL03232:Dmxl1 APN 18 49878180 missense probably benign 0.01
IGL03258:Dmxl1 APN 18 49920893 missense probably damaging 1.00
IGL03298:Dmxl1 APN 18 49864818 missense probably benign
carnivora UTSW 18 49864383 missense probably damaging 0.99
hibiscus UTSW 18 49889467 missense probably damaging 1.00
pitcher UTSW 18 49864148 missense probably damaging 1.00
R3889_Dmxl1_217 UTSW 18 49878259 missense probably damaging 1.00
PIT4810001:Dmxl1 UTSW 18 49931963 missense probably damaging 1.00
R0001:Dmxl1 UTSW 18 49888897 splice site probably benign
R0027:Dmxl1 UTSW 18 49957295 splice site probably benign
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0257:Dmxl1 UTSW 18 49955803 splice site probably benign
R0349:Dmxl1 UTSW 18 49879282 missense probably damaging 0.99
R0390:Dmxl1 UTSW 18 49879362 missense probably benign 0.14
R0511:Dmxl1 UTSW 18 49891467 nonsense probably null
R0539:Dmxl1 UTSW 18 49857430 splice site probably benign
R0542:Dmxl1 UTSW 18 49893694 missense probably benign 0.05
R0587:Dmxl1 UTSW 18 49935307 missense probably benign 0.39
R0635:Dmxl1 UTSW 18 49851423 splice site probably benign
R0744:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0836:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0845:Dmxl1 UTSW 18 49893402 missense probably damaging 1.00
R1218:Dmxl1 UTSW 18 49893611 missense probably damaging 1.00
R1278:Dmxl1 UTSW 18 49893225 missense probably benign
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1349:Dmxl1 UTSW 18 49888853 missense probably damaging 1.00
R1453:Dmxl1 UTSW 18 49857249 missense probably benign 0.05
R1522:Dmxl1 UTSW 18 49852367 missense probably benign 0.05
R1629:Dmxl1 UTSW 18 49859286 critical splice donor site probably null
R1638:Dmxl1 UTSW 18 49890767 nonsense probably null
R1646:Dmxl1 UTSW 18 49962261 missense probably damaging 1.00
R1719:Dmxl1 UTSW 18 49934637 missense probably damaging 1.00
R1732:Dmxl1 UTSW 18 49893444 nonsense probably null
R1732:Dmxl1 UTSW 18 49902988 missense probably benign
R1886:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1887:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1895:Dmxl1 UTSW 18 49955914 splice site probably null
R1911:Dmxl1 UTSW 18 49878163 missense probably benign 0.00
R2020:Dmxl1 UTSW 18 49889558 nonsense probably null
R2116:Dmxl1 UTSW 18 49878817 missense probably damaging 1.00
R2196:Dmxl1 UTSW 18 49917631 missense probably benign 0.00
R2206:Dmxl1 UTSW 18 49894094 missense probably benign 0.12
R2216:Dmxl1 UTSW 18 49893923 missense probably benign 0.00
R2255:Dmxl1 UTSW 18 49846639 missense probably benign 0.34
R2333:Dmxl1 UTSW 18 49919976 splice site probably null
R2343:Dmxl1 UTSW 18 49890678 missense probably damaging 1.00
R2496:Dmxl1 UTSW 18 49880791 missense possibly damaging 0.51
R3757:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3758:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3783:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3786:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3787:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3885:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3886:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3887:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3888:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3889:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R4014:Dmxl1 UTSW 18 49863962 missense probably benign
R4033:Dmxl1 UTSW 18 49851431 missense possibly damaging 0.95
R4096:Dmxl1 UTSW 18 49961197 missense probably damaging 1.00
R4366:Dmxl1 UTSW 18 49878017 nonsense probably null
R4406:Dmxl1 UTSW 18 49889553 missense probably damaging 1.00
R4412:Dmxl1 UTSW 18 49848761 missense probably benign
R4454:Dmxl1 UTSW 18 49893332 missense probably benign 0.01
R4459:Dmxl1 UTSW 18 49961216 missense possibly damaging 0.80
R4569:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4570:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4606:Dmxl1 UTSW 18 49962181 missense probably damaging 0.98
R4649:Dmxl1 UTSW 18 49878631 missense probably damaging 0.99
R4683:Dmxl1 UTSW 18 49878021 missense probably damaging 1.00
R4782:Dmxl1 UTSW 18 49862992 missense probably damaging 1.00
R4878:Dmxl1 UTSW 18 49851476 missense probably damaging 1.00
R4879:Dmxl1 UTSW 18 49889467 missense probably damaging 1.00
R4881:Dmxl1 UTSW 18 49957281 intron probably benign
R4885:Dmxl1 UTSW 18 49878795 missense probably damaging 0.99
R4916:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5022:Dmxl1 UTSW 18 49895127 missense probably damaging 0.99
R5056:Dmxl1 UTSW 18 49870923 missense probably benign 0.00
R5177:Dmxl1 UTSW 18 49893584 missense probably damaging 0.99
R5342:Dmxl1 UTSW 18 49951235 missense probably damaging 0.96
R5421:Dmxl1 UTSW 18 49863119 critical splice donor site probably null
R5433:Dmxl1 UTSW 18 49867899 splice site probably null
R5484:Dmxl1 UTSW 18 49889464 missense probably damaging 1.00
R5598:Dmxl1 UTSW 18 49864478 missense probably benign 0.04
R5633:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5638:Dmxl1 UTSW 18 49891626 missense possibly damaging 0.95
R5694:Dmxl1 UTSW 18 49894257 missense probably damaging 1.00
R5696:Dmxl1 UTSW 18 49931941 nonsense probably null
R5706:Dmxl1 UTSW 18 49957395 critical splice donor site probably null
R5745:Dmxl1 UTSW 18 49846586 missense probably benign
R5876:Dmxl1 UTSW 18 49870984 missense possibly damaging 0.70
R6054:Dmxl1 UTSW 18 49857386 missense probably benign 0.00
R6145:Dmxl1 UTSW 18 49912766 missense possibly damaging 0.90
R6189:Dmxl1 UTSW 18 49893335 missense probably benign 0.33
R6213:Dmxl1 UTSW 18 49863015 missense possibly damaging 0.93
R6219:Dmxl1 UTSW 18 49902367 missense probably damaging 0.99
R6221:Dmxl1 UTSW 18 49871732 missense probably damaging 0.96
R6276:Dmxl1 UTSW 18 49846586 missense probably benign
R6319:Dmxl1 UTSW 18 49852300 missense probably benign 0.00
R6426:Dmxl1 UTSW 18 49864578 missense probably damaging 0.99
R6567:Dmxl1 UTSW 18 49859179 missense probably damaging 0.99
R6739:Dmxl1 UTSW 18 49878246 missense probably benign 0.03
R6743:Dmxl1 UTSW 18 49880780 missense possibly damaging 0.95
R6776:Dmxl1 UTSW 18 49893974 missense probably damaging 1.00
R6827:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6828:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6829:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6830:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6833:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6834:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6856:Dmxl1 UTSW 18 49852288 nonsense probably null
R6857:Dmxl1 UTSW 18 49864835 missense probably damaging 0.99
R6881:Dmxl1 UTSW 18 49935305 missense probably benign 0.00
R6882:Dmxl1 UTSW 18 49843784 critical splice acceptor site probably null
R6892:Dmxl1 UTSW 18 49920902 missense probably damaging 0.98
R6897:Dmxl1 UTSW 18 49851495 missense probably null 0.99
R6897:Dmxl1 UTSW 18 49863057 missense possibly damaging 0.51
R6917:Dmxl1 UTSW 18 49864148 missense probably damaging 1.00
R7192:Dmxl1 UTSW 18 49955853 missense probably damaging 0.99
R7447:Dmxl1 UTSW 18 49864614 missense probably damaging 0.99
R7570:Dmxl1 UTSW 18 49893957 missense possibly damaging 0.82
R7626:Dmxl1 UTSW 18 49902794 missense probably benign
R7629:Dmxl1 UTSW 18 49859270 missense probably damaging 1.00
R7644:Dmxl1 UTSW 18 49893552 missense probably benign
R7688:Dmxl1 UTSW 18 49955871 missense probably benign 0.03
R7689:Dmxl1 UTSW 18 49846618 missense probably benign 0.00
R7712:Dmxl1 UTSW 18 49893461 missense probably damaging 0.99
R7808:Dmxl1 UTSW 18 49878315 missense probably benign 0.00
R7834:Dmxl1 UTSW 18 49920977 missense probably damaging 1.00
R7848:Dmxl1 UTSW 18 49840490 missense possibly damaging 0.88
R7849:Dmxl1 UTSW 18 49961147 missense probably benign 0.00
R7881:Dmxl1 UTSW 18 49864383 missense probably damaging 0.99
R7884:Dmxl1 UTSW 18 49893407 missense possibly damaging 0.65
R8073:Dmxl1 UTSW 18 49878433 missense probably damaging 1.00
R8089:Dmxl1 UTSW 18 49888830 missense probably damaging 0.99
R8266:Dmxl1 UTSW 18 49843811 missense probably benign 0.17
R8371:Dmxl1 UTSW 18 49898714 missense probably benign 0.08
R8402:Dmxl1 UTSW 18 49878326 nonsense probably null
R8402:Dmxl1 UTSW 18 49878327 missense probably benign 0.09
R8402:Dmxl1 UTSW 18 49878342 missense probably benign
R8423:Dmxl1 UTSW 18 49865116 missense probably damaging 1.00
R8678:Dmxl1 UTSW 18 49871692 nonsense probably null
R8702:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R8749:Dmxl1 UTSW 18 49955870 missense probably damaging 1.00
R8813:Dmxl1 UTSW 18 49957339 missense probably damaging 0.99
R8877:Dmxl1 UTSW 18 49878225 missense possibly damaging 0.55
R8945:Dmxl1 UTSW 18 49939572 missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 49864508 missense possibly damaging 0.96
R8971:Dmxl1 UTSW 18 49893674 missense probably damaging 1.00
R8978:Dmxl1 UTSW 18 49922612 missense probably benign 0.37
R8987:Dmxl1 UTSW 18 49893852 missense
R9011:Dmxl1 UTSW 18 49864173 missense probably damaging 1.00
RF009:Dmxl1 UTSW 18 49893394 missense probably damaging 0.96
X0025:Dmxl1 UTSW 18 49864368 missense probably damaging 0.98
X0066:Dmxl1 UTSW 18 49919899 missense probably damaging 1.00
Z1088:Dmxl1 UTSW 18 49920965 missense probably benign
Z1188:Dmxl1 UTSW 18 49868003 missense probably damaging 0.96
Z1189:Dmxl1 UTSW 18 49868003 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCTGTAGAAGGTGCCCCAC -3'
(R):5'- TCCGAACTTTGCCAAGATCCATG -3'

Sequencing Primer
(F):5'- ATGGGTCCGGGATGGCATC -3'
(R):5'- GAACTTTGCCAAGATCCATGAGTTCC -3'
Posted On2019-10-07