Mutagenetix > Incidental Mutations

Incidental Mutation 'R7461:Kansl3'

578427

Institutional Source

Beutler Lab

Gene Symbol

Kansl3

Ensembl Gene

ENSMUSG00000010453

Gene Name

KAT8 regulatory NSL complex subunit 3

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R7461 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

36335730-36369181 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 36343795 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 812 (S812F)

Ref Sequence

ENSEMBL: ENSMUSP00000140597 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010597] [ENSMUST00000185912] [ENSMUST00000186470] [ENSMUST00000188961]

Predicted Effect

probably damaging
Transcript: ENSMUST00000010597
AA Change: S786F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000010597
Gene: ENSMUSG00000010453
AA Change: S786F

Domain	Start	End	E-Value	Type
low complexity region	113	125	N/A	INTRINSIC
low complexity region	238	249	N/A	INTRINSIC
low complexity region	271	285	N/A	INTRINSIC
Pfam:Abhydrolase_5	288	436	2e-9	PFAM
low complexity region	523	555	N/A	INTRINSIC
low complexity region	669	697	N/A	INTRINSIC
low complexity region	718	732	N/A	INTRINSIC
low complexity region	735	751	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000185912
AA Change: S687F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140547
Gene: ENSMUSG00000010453
AA Change: S687F

Domain	Start	End	E-Value	Type
low complexity region	14	26	N/A	INTRINSIC
low complexity region	139	150	N/A	INTRINSIC
low complexity region	172	186	N/A	INTRINSIC
Pfam:Abhydrolase_5	189	337	9.3e-8	PFAM
low complexity region	424	456	N/A	INTRINSIC
low complexity region	570	598	N/A	INTRINSIC
low complexity region	619	633	N/A	INTRINSIC
low complexity region	636	652	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186470
AA Change: S812F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140597
Gene: ENSMUSG00000010453
AA Change: S812F

Domain	Start	End	E-Value	Type
low complexity region	113	125	N/A	INTRINSIC
low complexity region	238	249	N/A	INTRINSIC
low complexity region	271	285	N/A	INTRINSIC
Pfam:Abhydrolase_5	288	436	2.2e-9	PFAM
low complexity region	523	555	N/A	INTRINSIC
low complexity region	578	586	N/A	INTRINSIC
low complexity region	695	723	N/A	INTRINSIC
low complexity region	744	758	N/A	INTRINSIC
low complexity region	761	777	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000188961

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (53/53)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adgrb2	CTATA	CTATATA	4: 130,021,213		probably benign	Het
Akt2	A	G	7: 27,637,170	I448V	probably benign	Het
Anapc5	G	A	5: 122,818,865	T117M	probably damaging	Het
Arhgap10	T	C	8: 77,388,697	E358G	probably damaging	Het
C1qtnf6	T	A	15: 78,527,349	K42N	probably benign	Het
Cacna1d	A	T	14: 30,066,163	D1605E	probably benign	Het
Cdkl1	T	A	12: 69,756,461	I214L	probably benign	Het
Celsr2	C	T	3: 108,395,640	G2506R	probably damaging	Het
Cenpj	G	A	14: 56,527,044	R1304*	probably null	Het
Cfap58	A	G	19: 47,982,122	D593G	possibly damaging	Het
Crip2	T	C	12: 113,144,157		probably null	Het
Crocc2	G	T	1: 93,194,589	A735S	possibly damaging	Het
Dcc	A	T	18: 71,306,034	L1279H	probably damaging	Het
Dnah2	A	G	11: 69,548,990		probably null	Het
Dpp8	C	T	9: 65,053,120	T311M	possibly damaging	Het
Eps15	T	C	4: 109,329,725	S330P	probably damaging	Het
Exoc2	C	T	13: 30,882,272	V474I	probably benign	Het
Fmn1	A	G	2: 113,364,071	T39A	unknown	Het
Foxn2	T	C	17: 88,486,883	I416T	possibly damaging	Het
Gbp8	T	C	5: 105,031,014	E145G	probably damaging	Het
Gjd2	A	C	2: 114,011,118	S293A	possibly damaging	Het
Gm3676	T	A	14: 41,643,276	I141L	probably benign	Het
Gm4131	A	G	14: 62,481,089	Y23H	possibly damaging	Het
Gm884	G	T	11: 103,616,290	H1617Q	unknown	Het
Gucy1b1	T	A	3: 82,039,747	D385V	possibly damaging	Het
Hdac2	T	C	10: 36,989,236	S149P	probably damaging	Het
Igsf9b	A	T	9: 27,334,122	R1128S	probably benign	Het
Invs	A	G	4: 48,392,668	H294R	probably damaging	Het
Itgbl1	T	A	14: 123,827,799	S122T	possibly damaging	Het
Kcnt1	A	T	2: 25,901,346	H567L	probably benign	Het
Klhl30	G	T	1: 91,357,408	V329F	possibly damaging	Het
Krt33a	A	G	11: 100,011,939	I353T	probably damaging	Het
Lrrc7	T	C	3: 158,187,020	T331A	probably benign	Het
Megf10	G	T	18: 57,252,853	V313F	probably damaging	Het
Myo15	A	G	11: 60,505,152	T1438A		Het
Myocd	A	G	11: 65,218,603	L114P	probably damaging	Het
Olfr1444	A	T	19: 12,861,777	M1L	probably benign	Het
Pde4b	A	G	4: 102,255,306	E29G	probably damaging	Het
Por	G	T	5: 135,729,504	A112S	probably damaging	Het
Prkcq	T	C	2: 11,299,410	F651S	probably damaging	Het
Selenoi	A	G	5: 30,266,928	I376V	possibly damaging	Het
Setbp1	A	C	18: 78,856,492	M1320R	probably benign	Het
Skint6	A	T	4: 113,177,046		probably null	Het
Tdrd6	T	C	17: 43,627,926	T744A	probably benign	Het
Tmem209	C	T	6: 30,508,470	W61*	probably null	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Top1	A	T	2: 160,712,842		probably null	Het
Tradd	T	C	8: 105,260,564	K37E	possibly damaging	Het
Ttc28	C	A	5: 111,224,129	L846M	probably damaging	Het
Umodl1	T	A	17: 30,988,057	C807*	probably null	Het
Upf2	T	A	2: 5,973,536	S404T	unknown	Het
Wscd1	T	C	11: 71,759,973	L42P	possibly damaging	Het

Other mutations in Kansl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02220:Kansl3	APN	1	36367989	start gained	probably benign
IGL02277:Kansl3	APN	1	36348947	missense	possibly damaging	0.85
IGL02423:Kansl3	APN	1	36351969	missense	probably damaging	1.00
R0147:Kansl3	UTSW	1	36353816	missense	probably damaging	1.00
R0148:Kansl3	UTSW	1	36353816	missense	probably damaging	1.00
R0255:Kansl3	UTSW	1	36344969	missense	probably benign	0.01
R0279:Kansl3	UTSW	1	36351969	missense	probably damaging	0.99
R0349:Kansl3	UTSW	1	36351783	missense	probably damaging	1.00
R1452:Kansl3	UTSW	1	36354793	splice site	probably benign
R1599:Kansl3	UTSW	1	36367870	missense	probably damaging	1.00
R1842:Kansl3	UTSW	1	36351744	missense	probably damaging	1.00
R2310:Kansl3	UTSW	1	36343364	missense	probably damaging	1.00
R4093:Kansl3	UTSW	1	36344954	missense	probably damaging	1.00
R4961:Kansl3	UTSW	1	36348683	critical splice acceptor site	probably null
R5339:Kansl3	UTSW	1	36367721	intron	probably benign
R5400:Kansl3	UTSW	1	36358149	missense	possibly damaging	0.93
R5564:Kansl3	UTSW	1	36345964	missense	possibly damaging	0.55
R5661:Kansl3	UTSW	1	36348957	missense	possibly damaging	0.55
R5965:Kansl3	UTSW	1	36345520	intron	probably null
R6185:Kansl3	UTSW	1	36346018	missense	probably damaging	0.96
R6261:Kansl3	UTSW	1	36365605	missense	probably benign	0.01
R6706:Kansl3	UTSW	1	36344914	critical splice donor site	probably null
R7055:Kansl3	UTSW	1	36365620	missense	possibly damaging	0.86
R7134:Kansl3	UTSW	1	36351767	missense	possibly damaging	0.52
R7362:Kansl3	UTSW	1	36344127	missense	possibly damaging	0.82
R7571:Kansl3	UTSW	1	36365587	missense	possibly damaging	0.55
R7613:Kansl3	UTSW	1	36343795	missense	probably damaging	1.00
R7775:Kansl3	UTSW	1	36348677	missense	probably damaging	0.99
R7778:Kansl3	UTSW	1	36348677	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAGGTTCCACAGAGCTGAATC -3'
(R):5'- CTTGCTTGCCATGTGCTGAG -3'

Sequencing Primer
(F):5'- TTGCCTATCTAAGACCTGGAAATACC -3'
(R):5'- CCATGTGCTGAGTGGGCTC -3'

Posted On

2019-10-07