Incidental Mutation 'R7461:Crocc2'
ID578429
Institutional Source Beutler Lab
Gene Symbol Crocc2
Ensembl Gene ENSMUSG00000084989
Gene Nameciliary rootlet coiled-coil, rootletin family member 2
SynonymsLOC381284, E030010N08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7461 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location93168725-93231072 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 93194589 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 735 (A735S)
Ref Sequence ENSEMBL: ENSMUSP00000120588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138595]
Predicted Effect possibly damaging
Transcript: ENSMUST00000138595
AA Change: A735S

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120588
Gene: ENSMUSG00000084989
AA Change: A735S

DomainStartEndE-ValueType
low complexity region 67 82 N/A INTRINSIC
Pfam:Rootletin 89 260 5.1e-24 PFAM
coiled coil region 281 346 N/A INTRINSIC
internal_repeat_1 381 424 9.68e-9 PROSPERO
internal_repeat_3 389 414 5.46e-6 PROSPERO
internal_repeat_4 398 425 1.1e-5 PROSPERO
coiled coil region 426 627 N/A INTRINSIC
coiled coil region 655 1247 N/A INTRINSIC
internal_repeat_2 1252 1280 6.61e-7 PROSPERO
internal_repeat_4 1341 1374 1.1e-5 PROSPERO
internal_repeat_1 1347 1384 9.68e-9 PROSPERO
coiled coil region 1403 1512 N/A INTRINSIC
coiled coil region 1539 1582 N/A INTRINSIC
low complexity region 1590 1604 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adgrb2 CTATA CTATATA 4: 130,021,213 probably benign Het
Akt2 A G 7: 27,637,170 I448V probably benign Het
Anapc5 G A 5: 122,818,865 T117M probably damaging Het
Arhgap10 T C 8: 77,388,697 E358G probably damaging Het
C1qtnf6 T A 15: 78,527,349 K42N probably benign Het
Cacna1d A T 14: 30,066,163 D1605E probably benign Het
Cdkl1 T A 12: 69,756,461 I214L probably benign Het
Celsr2 C T 3: 108,395,640 G2506R probably damaging Het
Cenpj G A 14: 56,527,044 R1304* probably null Het
Cfap58 A G 19: 47,982,122 D593G possibly damaging Het
Crip2 T C 12: 113,144,157 probably null Het
Dcc A T 18: 71,306,034 L1279H probably damaging Het
Dnah2 A G 11: 69,548,990 probably null Het
Dpp8 C T 9: 65,053,120 T311M possibly damaging Het
Eps15 T C 4: 109,329,725 S330P probably damaging Het
Exoc2 C T 13: 30,882,272 V474I probably benign Het
Fmn1 A G 2: 113,364,071 T39A unknown Het
Foxn2 T C 17: 88,486,883 I416T possibly damaging Het
Gbp8 T C 5: 105,031,014 E145G probably damaging Het
Gjd2 A C 2: 114,011,118 S293A possibly damaging Het
Gm3676 T A 14: 41,643,276 I141L probably benign Het
Gm4131 A G 14: 62,481,089 Y23H possibly damaging Het
Gm884 G T 11: 103,616,290 H1617Q unknown Het
Gucy1b1 T A 3: 82,039,747 D385V possibly damaging Het
Hdac2 T C 10: 36,989,236 S149P probably damaging Het
Igsf9b A T 9: 27,334,122 R1128S probably benign Het
Invs A G 4: 48,392,668 H294R probably damaging Het
Itgbl1 T A 14: 123,827,799 S122T possibly damaging Het
Kansl3 G A 1: 36,343,795 S812F probably damaging Het
Kcnt1 A T 2: 25,901,346 H567L probably benign Het
Klhl30 G T 1: 91,357,408 V329F possibly damaging Het
Krt33a A G 11: 100,011,939 I353T probably damaging Het
Lrrc7 T C 3: 158,187,020 T331A probably benign Het
Megf10 G T 18: 57,252,853 V313F probably damaging Het
Myo15 A G 11: 60,505,152 T1438A Het
Myocd A G 11: 65,218,603 L114P probably damaging Het
Olfr1444 A T 19: 12,861,777 M1L probably benign Het
Pde4b A G 4: 102,255,306 E29G probably damaging Het
Por G T 5: 135,729,504 A112S probably damaging Het
Prkcq T C 2: 11,299,410 F651S probably damaging Het
Selenoi A G 5: 30,266,928 I376V possibly damaging Het
Setbp1 A C 18: 78,856,492 M1320R probably benign Het
Skint6 A T 4: 113,177,046 probably null Het
Tdrd6 T C 17: 43,627,926 T744A probably benign Het
Tmem209 C T 6: 30,508,470 W61* probably null Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Top1 A T 2: 160,712,842 probably null Het
Tradd T C 8: 105,260,564 K37E possibly damaging Het
Ttc28 C A 5: 111,224,129 L846M probably damaging Het
Umodl1 T A 17: 30,988,057 C807* probably null Het
Upf2 T A 2: 5,973,536 S404T unknown Het
Wscd1 T C 11: 71,759,973 L42P possibly damaging Het
Other mutations in Crocc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Crocc2 APN 1 93217044 nonsense probably null
R0396:Crocc2 UTSW 1 93224214 splice site probably benign
R1382:Crocc2 UTSW 1 93217093 critical splice donor site probably null
R4608:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4609:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4619:Crocc2 UTSW 1 93213650 missense probably benign
R4646:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4647:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4648:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4767:Crocc2 UTSW 1 93202856 missense possibly damaging 0.72
R4811:Crocc2 UTSW 1 93205896 missense probably damaging 0.99
R5046:Crocc2 UTSW 1 93205902 missense probably damaging 0.96
R5389:Crocc2 UTSW 1 93215641 missense probably benign 0.03
R5632:Crocc2 UTSW 1 93217853 missense probably damaging 0.98
R5887:Crocc2 UTSW 1 93194116 missense possibly damaging 0.47
R6128:Crocc2 UTSW 1 93194401 missense probably benign 0.28
R6142:Crocc2 UTSW 1 93190479 missense possibly damaging 0.61
R6258:Crocc2 UTSW 1 93213638 missense possibly damaging 0.57
R6260:Crocc2 UTSW 1 93213638 missense possibly damaging 0.57
R6288:Crocc2 UTSW 1 93194505 missense probably benign 0.07
R6312:Crocc2 UTSW 1 93215710 nonsense probably null
R6335:Crocc2 UTSW 1 93202838 missense probably benign 0.02
R6339:Crocc2 UTSW 1 93214032 missense probably benign 0.23
R6371:Crocc2 UTSW 1 93215631 missense probably benign 0.10
R6439:Crocc2 UTSW 1 93183404 missense possibly damaging 0.81
R6442:Crocc2 UTSW 1 93185053 missense probably benign 0.38
R6545:Crocc2 UTSW 1 93212937 missense probably benign 0.45
R6619:Crocc2 UTSW 1 93190501 missense probably benign 0.09
R6898:Crocc2 UTSW 1 93215582 missense probably benign 0.06
R7170:Crocc2 UTSW 1 93193982 missense possibly damaging 0.95
R7378:Crocc2 UTSW 1 93194087 missense probably damaging 0.98
R7395:Crocc2 UTSW 1 93216107 nonsense probably null
R7613:Crocc2 UTSW 1 93194589 missense possibly damaging 0.47
R7831:Crocc2 UTSW 1 93215473 missense probably benign 0.17
R7914:Crocc2 UTSW 1 93215473 missense probably benign 0.17
Z1177:Crocc2 UTSW 1 93213595 missense probably damaging 1.00
Z1177:Crocc2 UTSW 1 93226692 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAATGTATTCCCACCTGCCCTG -3'
(R):5'- ATATATACTGCTGTTGGCTCTTCCG -3'

Sequencing Primer
(F):5'- AGGAACGGGACCAGCTTC -3'
(R):5'- GTCCTGTAGATCCTTGCCAAC -3'
Posted On2019-10-07