Incidental Mutation 'R7461:Upf2'
ID578430
Institutional Source Beutler Lab
Gene Symbol Upf2
Ensembl Gene ENSMUSG00000043241
Gene NameUPF2 regulator of nonsense transcripts homolog (yeast)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7461 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location5951469-6056703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5973536 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 404 (S404T)
Ref Sequence ENSEMBL: ENSMUSP00000058375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060092]
Predicted Effect unknown
Transcript: ENSMUST00000060092
AA Change: S404T
SMART Domains Protein: ENSMUSP00000058375
Gene: ENSMUSG00000043241
AA Change: S404T

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
low complexity region 54 125 N/A INTRINSIC
MIF4G 167 363 1.22e-32 SMART
coiled coil region 514 543 N/A INTRINSIC
MIF4G 567 756 1.13e-50 SMART
MIF4G 771 984 3.43e-50 SMART
low complexity region 1023 1042 N/A INTRINSIC
Pfam:Upf2 1051 1215 1.5e-45 PFAM
Meta Mutation Damage Score 0.1634 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located in the perinuclear area. It interacts with translation release factors and the proteins that are functional homologs of yeast Upf1p and Upf3p. Two splice variants have been found for this gene; both variants encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adgrb2 CTATA CTATATA 4: 130,021,213 probably benign Het
Akt2 A G 7: 27,637,170 I448V probably benign Het
Anapc5 G A 5: 122,818,865 T117M probably damaging Het
Arhgap10 T C 8: 77,388,697 E358G probably damaging Het
C1qtnf6 T A 15: 78,527,349 K42N probably benign Het
Cacna1d A T 14: 30,066,163 D1605E probably benign Het
Cdkl1 T A 12: 69,756,461 I214L probably benign Het
Celsr2 C T 3: 108,395,640 G2506R probably damaging Het
Cenpj G A 14: 56,527,044 R1304* probably null Het
Cfap58 A G 19: 47,982,122 D593G possibly damaging Het
Crip2 T C 12: 113,144,157 probably null Het
Crocc2 G T 1: 93,194,589 A735S possibly damaging Het
Dcc A T 18: 71,306,034 L1279H probably damaging Het
Dnah2 A G 11: 69,548,990 probably null Het
Dpp8 C T 9: 65,053,120 T311M possibly damaging Het
Eps15 T C 4: 109,329,725 S330P probably damaging Het
Exoc2 C T 13: 30,882,272 V474I probably benign Het
Fmn1 A G 2: 113,364,071 T39A unknown Het
Foxn2 T C 17: 88,486,883 I416T possibly damaging Het
Gbp8 T C 5: 105,031,014 E145G probably damaging Het
Gjd2 A C 2: 114,011,118 S293A possibly damaging Het
Gm3676 T A 14: 41,643,276 I141L probably benign Het
Gm4131 A G 14: 62,481,089 Y23H possibly damaging Het
Gm884 G T 11: 103,616,290 H1617Q unknown Het
Gucy1b1 T A 3: 82,039,747 D385V possibly damaging Het
Hdac2 T C 10: 36,989,236 S149P probably damaging Het
Igsf9b A T 9: 27,334,122 R1128S probably benign Het
Invs A G 4: 48,392,668 H294R probably damaging Het
Itgbl1 T A 14: 123,827,799 S122T possibly damaging Het
Kansl3 G A 1: 36,343,795 S812F probably damaging Het
Kcnt1 A T 2: 25,901,346 H567L probably benign Het
Klhl30 G T 1: 91,357,408 V329F possibly damaging Het
Krt33a A G 11: 100,011,939 I353T probably damaging Het
Lrrc7 T C 3: 158,187,020 T331A probably benign Het
Megf10 G T 18: 57,252,853 V313F probably damaging Het
Myo15 A G 11: 60,505,152 T1438A Het
Myocd A G 11: 65,218,603 L114P probably damaging Het
Olfr1444 A T 19: 12,861,777 M1L probably benign Het
Pde4b A G 4: 102,255,306 E29G probably damaging Het
Por G T 5: 135,729,504 A112S probably damaging Het
Prkcq T C 2: 11,299,410 F651S probably damaging Het
Selenoi A G 5: 30,266,928 I376V possibly damaging Het
Setbp1 A C 18: 78,856,492 M1320R probably benign Het
Skint6 A T 4: 113,177,046 probably null Het
Tdrd6 T C 17: 43,627,926 T744A probably benign Het
Tmem209 C T 6: 30,508,470 W61* probably null Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Top1 A T 2: 160,712,842 probably null Het
Tradd T C 8: 105,260,564 K37E possibly damaging Het
Ttc28 C A 5: 111,224,129 L846M probably damaging Het
Umodl1 T A 17: 30,988,057 C807* probably null Het
Wscd1 T C 11: 71,759,973 L42P possibly damaging Het
Other mutations in Upf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Upf2 APN 2 5961300 missense unknown
IGL01394:Upf2 APN 2 6040213 splice site probably null
IGL01571:Upf2 APN 2 6018939 unclassified probably benign
IGL01624:Upf2 APN 2 6034179 missense probably benign
IGL02121:Upf2 APN 2 6026323 splice site probably benign
IGL02485:Upf2 APN 2 6027291 missense unknown
IGL02491:Upf2 APN 2 6026164 missense unknown
R0265:Upf2 UTSW 2 6027204 splice site probably benign
R0390:Upf2 UTSW 2 6018894 unclassified probably benign
R0480:Upf2 UTSW 2 5957634 missense possibly damaging 0.71
R0513:Upf2 UTSW 2 5957667 missense unknown
R0579:Upf2 UTSW 2 5988429 missense unknown
R0612:Upf2 UTSW 2 6034098 splice site probably benign
R0856:Upf2 UTSW 2 5957652 missense unknown
R1103:Upf2 UTSW 2 6026175 missense unknown
R1384:Upf2 UTSW 2 5960989 missense unknown
R1672:Upf2 UTSW 2 6040097 splice site probably null
R1728:Upf2 UTSW 2 6027450 missense probably damaging 1.00
R1784:Upf2 UTSW 2 6027450 missense probably damaging 1.00
R1836:Upf2 UTSW 2 6050324 splice site probably null
R2252:Upf2 UTSW 2 5961460 missense unknown
R2339:Upf2 UTSW 2 6040102 splice site probably benign
R3015:Upf2 UTSW 2 5976079 missense unknown
R3931:Upf2 UTSW 2 6047010 missense unknown
R4151:Upf2 UTSW 2 5961705 missense unknown
R4283:Upf2 UTSW 2 5973558 missense unknown
R4558:Upf2 UTSW 2 5973593 missense unknown
R4564:Upf2 UTSW 2 6027312 missense unknown
R5630:Upf2 UTSW 2 6027301 missense probably damaging 0.99
R6370:Upf2 UTSW 2 5976010 missense unknown
R6418:Upf2 UTSW 2 6027339 missense unknown
R6432:Upf2 UTSW 2 5979777 missense unknown
R7184:Upf2 UTSW 2 6023320 missense unknown
R7308:Upf2 UTSW 2 5973518 missense unknown
R7371:Upf2 UTSW 2 5961040 missense unknown
R7404:Upf2 UTSW 2 6040203 missense unknown
R7439:Upf2 UTSW 2 6018932 missense unknown
R7441:Upf2 UTSW 2 6018932 missense unknown
R7483:Upf2 UTSW 2 6027408 missense unknown
R7613:Upf2 UTSW 2 5973536 missense unknown
R7976:Upf2 UTSW 2 6026115 missense unknown
R8044:Upf2 UTSW 2 6029438 missense unknown
Z1176:Upf2 UTSW 2 6023388 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAGCATTATGTTAACTTTCTGTGT -3'
(R):5'- CACTGGACATTTACCTCTGAACT -3'

Sequencing Primer
(F):5'- CGTGTTCACTGTGACAAG -3'
(R):5'- AGGTCTGGAGTTCAAATCCCAGC -3'
Posted On2019-10-07