Incidental Mutation 'R7461:Eps15'
ID578440
Institutional Source Beutler Lab
Gene Symbol Eps15
Ensembl Gene ENSMUSG00000028552
Gene Nameepidermal growth factor receptor pathway substrate 15
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7461 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location109280268-109387817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109329725 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 330 (S330P)
Ref Sequence ENSEMBL: ENSMUSP00000099790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102729] [ENSMUST00000132165] [ENSMUST00000175776] [ENSMUST00000176251]
PDB Structure
AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH EPS15 DPF PEPTIDE [X-RAY DIFFRACTION]
AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH EPS15 DPF PEPTIDE [X-RAY DIFFRACTION]
SOLUTION STRUCTURE OF THE APO EH1 DOMAIN OF MOUSE EPIDERMAL GROWTH FACTOR RECEPTOR SUBSTRATE 15, EPS15 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000102729
AA Change: S330P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099790
Gene: ENSMUSG00000028552
AA Change: S330P

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 502 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
internal_repeat_2 622 655 1.25e-5 PROSPERO
low complexity region 662 685 N/A INTRINSIC
low complexity region 744 754 N/A INTRINSIC
low complexity region 774 792 N/A INTRINSIC
internal_repeat_2 799 831 1.25e-5 PROSPERO
UIM 852 871 3.32e0 SMART
UIM 878 897 1.55e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132165
AA Change: S330P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118949
Gene: ENSMUSG00000028552
AA Change: S330P

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 429 N/A INTRINSIC
low complexity region 529 552 N/A INTRINSIC
low complexity region 611 621 N/A INTRINSIC
low complexity region 641 659 N/A INTRINSIC
UIM 719 738 3.32e0 SMART
UIM 745 764 1.55e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175776
AA Change: S366P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135270
Gene: ENSMUSG00000028552
AA Change: S366P

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 253 349 4.38e-48 SMART
EFh 263 291 1.2e1 SMART
EFh 297 325 6.82e1 SMART
coiled coil region 365 538 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
internal_repeat_2 658 691 1.92e-5 PROSPERO
low complexity region 698 721 N/A INTRINSIC
low complexity region 780 790 N/A INTRINSIC
low complexity region 810 828 N/A INTRINSIC
internal_repeat_2 835 867 1.92e-5 PROSPERO
UIM 888 907 3.32e0 SMART
UIM 914 933 1.55e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000176251
AA Change: S330P

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135034
Gene: ENSMUSG00000028552
AA Change: S330P

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 502 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
low complexity region 662 685 N/A INTRINSIC
low complexity region 744 754 N/A INTRINSIC
low complexity region 774 791 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of the EGFR pathway. The protein is present at clatherin-coated pits and is involved in receptor-mediated endocytosis of EGF. Notably, this gene is rearranged with the HRX/ALL/MLL gene in acute myelogeneous leukemias. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for a null allele show increased marginal zone B cell number with no changes in precursor cells, proliferation, apoptosis, migration or B cell responses. Homozygotes for a different null allele show decreased mean corpuscular hemoglobin (MCH), decreased MCH concentration, and dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adgrb2 CTATA CTATATA 4: 130,021,213 probably benign Het
Akt2 A G 7: 27,637,170 I448V probably benign Het
Anapc5 G A 5: 122,818,865 T117M probably damaging Het
Arhgap10 T C 8: 77,388,697 E358G probably damaging Het
C1qtnf6 T A 15: 78,527,349 K42N probably benign Het
Cacna1d A T 14: 30,066,163 D1605E probably benign Het
Cdkl1 T A 12: 69,756,461 I214L probably benign Het
Celsr2 C T 3: 108,395,640 G2506R probably damaging Het
Cenpj G A 14: 56,527,044 R1304* probably null Het
Cfap58 A G 19: 47,982,122 D593G possibly damaging Het
Crip2 T C 12: 113,144,157 probably null Het
Crocc2 G T 1: 93,194,589 A735S possibly damaging Het
Dcc A T 18: 71,306,034 L1279H probably damaging Het
Dnah2 A G 11: 69,548,990 probably null Het
Dpp8 C T 9: 65,053,120 T311M possibly damaging Het
Exoc2 C T 13: 30,882,272 V474I probably benign Het
Fmn1 A G 2: 113,364,071 T39A unknown Het
Foxn2 T C 17: 88,486,883 I416T possibly damaging Het
Gbp8 T C 5: 105,031,014 E145G probably damaging Het
Gjd2 A C 2: 114,011,118 S293A possibly damaging Het
Gm3676 T A 14: 41,643,276 I141L probably benign Het
Gm4131 A G 14: 62,481,089 Y23H possibly damaging Het
Gm884 G T 11: 103,616,290 H1617Q unknown Het
Gucy1b1 T A 3: 82,039,747 D385V possibly damaging Het
Hdac2 T C 10: 36,989,236 S149P probably damaging Het
Igsf9b A T 9: 27,334,122 R1128S probably benign Het
Invs A G 4: 48,392,668 H294R probably damaging Het
Itgbl1 T A 14: 123,827,799 S122T possibly damaging Het
Kansl3 G A 1: 36,343,795 S812F probably damaging Het
Kcnt1 A T 2: 25,901,346 H567L probably benign Het
Klhl30 G T 1: 91,357,408 V329F possibly damaging Het
Krt33a A G 11: 100,011,939 I353T probably damaging Het
Lrrc7 T C 3: 158,187,020 T331A probably benign Het
Megf10 G T 18: 57,252,853 V313F probably damaging Het
Myo15 A G 11: 60,505,152 T1438A Het
Myocd A G 11: 65,218,603 L114P probably damaging Het
Olfr1444 A T 19: 12,861,777 M1L probably benign Het
Pde4b A G 4: 102,255,306 E29G probably damaging Het
Por G T 5: 135,729,504 A112S probably damaging Het
Prkcq T C 2: 11,299,410 F651S probably damaging Het
Selenoi A G 5: 30,266,928 I376V possibly damaging Het
Setbp1 A C 18: 78,856,492 M1320R probably benign Het
Tdrd6 T C 17: 43,627,926 T744A probably benign Het
Tmem209 C T 6: 30,508,470 W61* probably null Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tradd T C 8: 105,260,564 K37E possibly damaging Het
Ttc28 C A 5: 111,224,129 L846M probably damaging Het
Umodl1 T A 17: 30,988,057 C807* probably null Het
Upf2 T A 2: 5,973,536 S404T unknown Het
Wscd1 T C 11: 71,759,973 L42P possibly damaging Het
Other mutations in Eps15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Eps15 APN 4 109309149 missense probably damaging 0.99
IGL01372:Eps15 APN 4 109322106 missense probably damaging 1.00
IGL01642:Eps15 APN 4 109366473 missense probably benign 0.00
IGL02207:Eps15 APN 4 109304748 splice site probably benign
IGL02394:Eps15 APN 4 109312965 missense probably damaging 1.00
IGL02755:Eps15 APN 4 109329698 missense probably benign 0.17
R0117:Eps15 UTSW 4 109382819 missense probably damaging 0.96
R0414:Eps15 UTSW 4 109366480 missense probably damaging 0.96
R0928:Eps15 UTSW 4 109312963 missense possibly damaging 0.95
R1545:Eps15 UTSW 4 109312329 missense probably benign 0.00
R1581:Eps15 UTSW 4 109363186 missense probably benign 0.15
R1627:Eps15 UTSW 4 109370557 missense probably damaging 1.00
R1756:Eps15 UTSW 4 109312918 nonsense probably null
R1799:Eps15 UTSW 4 109382837 missense probably damaging 1.00
R1906:Eps15 UTSW 4 109324201 missense possibly damaging 0.89
R1916:Eps15 UTSW 4 109368974 missense probably damaging 1.00
R2042:Eps15 UTSW 4 109304767 missense probably damaging 0.98
R2046:Eps15 UTSW 4 109370596 missense probably damaging 1.00
R2163:Eps15 UTSW 4 109370669 missense probably damaging 0.98
R2213:Eps15 UTSW 4 109361220 missense probably damaging 1.00
R2362:Eps15 UTSW 4 109361230 missense probably benign 0.06
R3151:Eps15 UTSW 4 109366222 missense probably benign 0.02
R3712:Eps15 UTSW 4 109309177 missense probably damaging 1.00
R3727:Eps15 UTSW 4 109370685 splice site probably benign
R4361:Eps15 UTSW 4 109380031 critical splice donor site probably null
R4381:Eps15 UTSW 4 109366530 unclassified probably benign
R4466:Eps15 UTSW 4 109366530 unclassified probably benign
R4740:Eps15 UTSW 4 109343190 missense probably damaging 1.00
R4797:Eps15 UTSW 4 109366530 unclassified probably benign
R4799:Eps15 UTSW 4 109366530 unclassified probably benign
R4801:Eps15 UTSW 4 109324217 missense possibly damaging 0.95
R4802:Eps15 UTSW 4 109324217 missense possibly damaging 0.95
R4864:Eps15 UTSW 4 109366530 unclassified probably benign
R4954:Eps15 UTSW 4 109370678 splice site probably null
R5134:Eps15 UTSW 4 109366530 unclassified probably benign
R5386:Eps15 UTSW 4 109321225 missense possibly damaging 0.48
R5768:Eps15 UTSW 4 109363176 splice site probably null
R5870:Eps15 UTSW 4 109361310 missense probably damaging 0.98
R6245:Eps15 UTSW 4 109382866 missense possibly damaging 0.66
R6290:Eps15 UTSW 4 109363198 missense probably benign 0.37
R6291:Eps15 UTSW 4 109305703 frame shift probably null
R6493:Eps15 UTSW 4 109368948 missense probably damaging 1.00
R6813:Eps15 UTSW 4 109280402 utr 5 prime probably null
R6885:Eps15 UTSW 4 109309164 missense probably damaging 0.99
R6913:Eps15 UTSW 4 109361230 missense probably benign 0.06
R7362:Eps15 UTSW 4 109366242 critical splice donor site probably null
R7613:Eps15 UTSW 4 109329725 missense probably damaging 1.00
X0023:Eps15 UTSW 4 109343357 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTTTCTGGAGATTATAAGAGAACTG -3'
(R):5'- AAGCATTCTGATTCCATTTACACAG -3'

Sequencing Primer
(F):5'- GTCTCTCTGTATAGCTTTTATCA -3'
(R):5'- TGAGGGTATGTATATGTAGTACA -3'
Posted On2019-10-07