Incidental Mutation 'R7461:Cenpj'
ID578466
Institutional Source Beutler Lab
Gene Symbol Cenpj
Ensembl Gene ENSMUSG00000064128
Gene Namecentromere protein J
Synonyms4932437H03Rik, Sas4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7461 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location56526761-56575425 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 56527044 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 1304 (R1304*)
Ref Sequence ENSEMBL: ENSMUSP00000065949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065302] [ENSMUST00000095793] [ENSMUST00000225951]
Predicted Effect probably null
Transcript: ENSMUST00000065302
AA Change: R1304*
SMART Domains Protein: ENSMUSP00000065949
Gene: ENSMUSG00000064128
AA Change: R1304*

DomainStartEndE-ValueType
low complexity region 60 76 N/A INTRINSIC
coiled coil region 140 185 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
low complexity region 547 570 N/A INTRINSIC
low complexity region 860 871 N/A INTRINSIC
coiled coil region 899 1046 N/A INTRINSIC
low complexity region 1144 1154 N/A INTRINSIC
Pfam:Tcp10_C 1167 1342 5.1e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095793
SMART Domains Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365

DomainStartEndE-ValueType
Blast:RING 9 72 2e-15 BLAST
low complexity region 398 405 N/A INTRINSIC
Pfam:TUDOR 440 522 8.2e-8 PFAM
TUDOR 750 807 4.32e-12 SMART
low complexity region 824 836 N/A INTRINSIC
Blast:TUDOR 850 882 1e-8 BLAST
low complexity region 959 970 N/A INTRINSIC
TUDOR 984 1042 1.29e-1 SMART
low complexity region 1128 1139 N/A INTRINSIC
TUDOR 1245 1301 7.7e-9 SMART
low complexity region 1416 1430 N/A INTRINSIC
TUDOR 1495 1554 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225737
Predicted Effect probably null
Transcript: ENSMUST00000225951
AA Change: R1304*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the centromere protein family. During cell division, this protein plays a structural role in the maintenance of centrosome integrity and normal spindle morphology, and it is involved in microtubule disassembly at the centrosome. This protein can function as a transcriptional coactivator in the Stat5 signaling pathway, and also as a coactivator of NF-kappaB-mediated transcription, likely via its interaction with the coactivator p300/CREB-binding protein. Mutations in this gene are associated with primary autosomal recessive microcephaly, a disorder characterized by severely reduced brain size and mental retardation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for null alleles exhibit embryonic lethality during early organogenesis and may show failure of embryo turning and absence of centrioles, cilia and centrosomes. Mice homozygous for a hypomorphic allele display partial lethality, dwarfism and a wide range of abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adgrb2 CTATA CTATATA 4: 130,021,213 probably benign Het
Akt2 A G 7: 27,637,170 I448V probably benign Het
Anapc5 G A 5: 122,818,865 T117M probably damaging Het
Arhgap10 T C 8: 77,388,697 E358G probably damaging Het
C1qtnf6 T A 15: 78,527,349 K42N probably benign Het
Cacna1d A T 14: 30,066,163 D1605E probably benign Het
Cdkl1 T A 12: 69,756,461 I214L probably benign Het
Celsr2 C T 3: 108,395,640 G2506R probably damaging Het
Cfap58 A G 19: 47,982,122 D593G possibly damaging Het
Crip2 T C 12: 113,144,157 probably null Het
Crocc2 G T 1: 93,194,589 A735S possibly damaging Het
Dcc A T 18: 71,306,034 L1279H probably damaging Het
Dnah2 A G 11: 69,548,990 probably null Het
Dpp8 C T 9: 65,053,120 T311M possibly damaging Het
Eps15 T C 4: 109,329,725 S330P probably damaging Het
Exoc2 C T 13: 30,882,272 V474I probably benign Het
Fmn1 A G 2: 113,364,071 T39A unknown Het
Foxn2 T C 17: 88,486,883 I416T possibly damaging Het
Gbp8 T C 5: 105,031,014 E145G probably damaging Het
Gjd2 A C 2: 114,011,118 S293A possibly damaging Het
Gm3676 T A 14: 41,643,276 I141L probably benign Het
Gm4131 A G 14: 62,481,089 Y23H possibly damaging Het
Gm884 G T 11: 103,616,290 H1617Q unknown Het
Gucy1b1 T A 3: 82,039,747 D385V possibly damaging Het
Hdac2 T C 10: 36,989,236 S149P probably damaging Het
Igsf9b A T 9: 27,334,122 R1128S probably benign Het
Invs A G 4: 48,392,668 H294R probably damaging Het
Itgbl1 T A 14: 123,827,799 S122T possibly damaging Het
Kansl3 G A 1: 36,343,795 S812F probably damaging Het
Kcnt1 A T 2: 25,901,346 H567L probably benign Het
Klhl30 G T 1: 91,357,408 V329F possibly damaging Het
Krt33a A G 11: 100,011,939 I353T probably damaging Het
Lrrc7 T C 3: 158,187,020 T331A probably benign Het
Megf10 G T 18: 57,252,853 V313F probably damaging Het
Myo15 A G 11: 60,505,152 T1438A Het
Myocd A G 11: 65,218,603 L114P probably damaging Het
Olfr1444 A T 19: 12,861,777 M1L probably benign Het
Pde4b A G 4: 102,255,306 E29G probably damaging Het
Por G T 5: 135,729,504 A112S probably damaging Het
Prkcq T C 2: 11,299,410 F651S probably damaging Het
Selenoi A G 5: 30,266,928 I376V possibly damaging Het
Setbp1 A C 18: 78,856,492 M1320R probably benign Het
Skint6 A T 4: 113,177,046 probably null Het
Tdrd6 T C 17: 43,627,926 T744A probably benign Het
Tmem209 C T 6: 30,508,470 W61* probably null Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Top1 A T 2: 160,712,842 probably null Het
Tradd T C 8: 105,260,564 K37E possibly damaging Het
Ttc28 C A 5: 111,224,129 L846M probably damaging Het
Umodl1 T A 17: 30,988,057 C807* probably null Het
Upf2 T A 2: 5,973,536 S404T unknown Het
Wscd1 T C 11: 71,759,973 L42P possibly damaging Het
Other mutations in Cenpj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Cenpj APN 14 56553030 missense probably benign 0.04
IGL00969:Cenpj APN 14 56564963 missense possibly damaging 0.68
IGL01152:Cenpj APN 14 56552300 missense probably benign 0.01
IGL01475:Cenpj APN 14 56565045 missense possibly damaging 0.80
IGL01548:Cenpj APN 14 56532319 missense probably benign 0.00
IGL01893:Cenpj APN 14 56553474 missense probably damaging 1.00
IGL02647:Cenpj APN 14 56530079 missense probably damaging 0.99
IGL02683:Cenpj APN 14 56552952 missense possibly damaging 0.88
IGL02691:Cenpj APN 14 56552090 missense probably benign 0.28
IGL03008:Cenpj APN 14 56526949 missense probably benign 0.39
R0206:Cenpj UTSW 14 56563970 missense probably benign 0.00
R0208:Cenpj UTSW 14 56563970 missense probably benign 0.00
R0356:Cenpj UTSW 14 56549496 missense probably damaging 1.00
R0942:Cenpj UTSW 14 56555209 unclassified probably benign
R1392:Cenpj UTSW 14 56534854 splice site probably benign
R1564:Cenpj UTSW 14 56552066 missense probably benign 0.43
R1671:Cenpj UTSW 14 56565045 missense probably damaging 0.99
R1889:Cenpj UTSW 14 56558725 missense probably benign 0.43
R2059:Cenpj UTSW 14 56563955 missense possibly damaging 0.94
R2140:Cenpj UTSW 14 56526932 missense probably damaging 1.00
R2509:Cenpj UTSW 14 56532237 missense probably null 0.98
R2866:Cenpj UTSW 14 56552180 missense probably benign 0.01
R3813:Cenpj UTSW 14 56553222 missense probably benign 0.05
R4620:Cenpj UTSW 14 56535454 missense probably damaging 0.99
R4670:Cenpj UTSW 14 56553383 missense possibly damaging 0.80
R4671:Cenpj UTSW 14 56553383 missense possibly damaging 0.80
R4765:Cenpj UTSW 14 56549545 nonsense probably null
R4915:Cenpj UTSW 14 56553718 missense probably damaging 0.98
R4930:Cenpj UTSW 14 56534781 nonsense probably null
R5088:Cenpj UTSW 14 56553691 missense probably damaging 1.00
R5523:Cenpj UTSW 14 56552423 missense probably benign 0.00
R5527:Cenpj UTSW 14 56526983 missense probably damaging 1.00
R5717:Cenpj UTSW 14 56553521 frame shift probably null
R5944:Cenpj UTSW 14 56553658 critical splice donor site probably null
R5975:Cenpj UTSW 14 56564066 missense possibly damaging 0.92
R6019:Cenpj UTSW 14 56534815 missense probably benign 0.01
R6291:Cenpj UTSW 14 56551976 missense probably benign 0.01
R6948:Cenpj UTSW 14 56553226 missense probably damaging 0.96
R7212:Cenpj UTSW 14 56552652 missense probably benign 0.00
R7613:Cenpj UTSW 14 56527044 nonsense probably null
R7634:Cenpj UTSW 14 56542800 missense probably benign 0.00
R7837:Cenpj UTSW 14 56558728 missense probably benign 0.02
RF007:Cenpj UTSW 14 56530048 critical splice donor site probably null
Z1177:Cenpj UTSW 14 56552879 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GCACTAGATAAGCCACTTACTTTTG -3'
(R):5'- AGACCAACAGTGTGTTTAGGAG -3'

Sequencing Primer
(F):5'- ACTCTGAACAGAAAAAGCACTTAGTG -3'
(R):5'- GGATTGACTTAAGGCCTCATGCAC -3'
Posted On2019-10-07