Incidental Mutation 'R7461:C1qtnf6'
ID578469
Institutional Source Beutler Lab
Gene Symbol C1qtnf6
Ensembl Gene ENSMUSG00000022440
Gene NameC1q and tumor necrosis factor related protein 6
SynonymsCTRP6, 2810036M19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7461 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location78523346-78531416 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78527349 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 42 (K42N)
Ref Sequence ENSEMBL: ENSMUSP00000023075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023075] [ENSMUST00000229185] [ENSMUST00000230943]
Predicted Effect probably benign
Transcript: ENSMUST00000023075
AA Change: K42N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000023075
Gene: ENSMUSG00000022440
AA Change: K42N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
C1Q 123 262 1.01e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000229185
AA Change: K42N

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000230943
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adgrb2 CTATA CTATATA 4: 130,021,213 probably benign Het
Akt2 A G 7: 27,637,170 I448V probably benign Het
Anapc5 G A 5: 122,818,865 T117M probably damaging Het
Arhgap10 T C 8: 77,388,697 E358G probably damaging Het
Cacna1d A T 14: 30,066,163 D1605E probably benign Het
Cdkl1 T A 12: 69,756,461 I214L probably benign Het
Celsr2 C T 3: 108,395,640 G2506R probably damaging Het
Cenpj G A 14: 56,527,044 R1304* probably null Het
Cfap58 A G 19: 47,982,122 D593G possibly damaging Het
Crip2 T C 12: 113,144,157 probably null Het
Crocc2 G T 1: 93,194,589 A735S possibly damaging Het
Dcc A T 18: 71,306,034 L1279H probably damaging Het
Dnah2 A G 11: 69,548,990 probably null Het
Dpp8 C T 9: 65,053,120 T311M possibly damaging Het
Eps15 T C 4: 109,329,725 S330P probably damaging Het
Exoc2 C T 13: 30,882,272 V474I probably benign Het
Fmn1 A G 2: 113,364,071 T39A unknown Het
Foxn2 T C 17: 88,486,883 I416T possibly damaging Het
Gbp8 T C 5: 105,031,014 E145G probably damaging Het
Gjd2 A C 2: 114,011,118 S293A possibly damaging Het
Gm3676 T A 14: 41,643,276 I141L probably benign Het
Gm4131 A G 14: 62,481,089 Y23H possibly damaging Het
Gm884 G T 11: 103,616,290 H1617Q unknown Het
Gucy1b1 T A 3: 82,039,747 D385V possibly damaging Het
Hdac2 T C 10: 36,989,236 S149P probably damaging Het
Igsf9b A T 9: 27,334,122 R1128S probably benign Het
Invs A G 4: 48,392,668 H294R probably damaging Het
Itgbl1 T A 14: 123,827,799 S122T possibly damaging Het
Kansl3 G A 1: 36,343,795 S812F probably damaging Het
Kcnt1 A T 2: 25,901,346 H567L probably benign Het
Klhl30 G T 1: 91,357,408 V329F possibly damaging Het
Krt33a A G 11: 100,011,939 I353T probably damaging Het
Lrrc7 T C 3: 158,187,020 T331A probably benign Het
Megf10 G T 18: 57,252,853 V313F probably damaging Het
Myo15 A G 11: 60,505,152 T1438A Het
Myocd A G 11: 65,218,603 L114P probably damaging Het
Olfr1444 A T 19: 12,861,777 M1L probably benign Het
Pde4b A G 4: 102,255,306 E29G probably damaging Het
Por G T 5: 135,729,504 A112S probably damaging Het
Prkcq T C 2: 11,299,410 F651S probably damaging Het
Selenoi A G 5: 30,266,928 I376V possibly damaging Het
Setbp1 A C 18: 78,856,492 M1320R probably benign Het
Skint6 A T 4: 113,177,046 probably null Het
Tdrd6 T C 17: 43,627,926 T744A probably benign Het
Tmem209 C T 6: 30,508,470 W61* probably null Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Top1 A T 2: 160,712,842 probably null Het
Tradd T C 8: 105,260,564 K37E possibly damaging Het
Ttc28 C A 5: 111,224,129 L846M probably damaging Het
Umodl1 T A 17: 30,988,057 C807* probably null Het
Upf2 T A 2: 5,973,536 S404T unknown Het
Wscd1 T C 11: 71,759,973 L42P possibly damaging Het
Other mutations in C1qtnf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:C1qtnf6 APN 15 78524894 missense probably damaging 1.00
IGL01534:C1qtnf6 APN 15 78525216 missense probably benign 0.44
IGL02072:C1qtnf6 APN 15 78527351 nonsense probably null
Santa UTSW 15 78524892 unclassified probably null
R1524:C1qtnf6 UTSW 15 78524892 unclassified probably null
R1720:C1qtnf6 UTSW 15 78527440 missense probably damaging 0.99
R2299:C1qtnf6 UTSW 15 78525342 missense probably benign 0.00
R4271:C1qtnf6 UTSW 15 78525266 missense probably benign 0.01
R5731:C1qtnf6 UTSW 15 78527314 missense probably benign 0.00
R6118:C1qtnf6 UTSW 15 78525395 missense probably damaging 0.99
R7140:C1qtnf6 UTSW 15 78525083 missense probably benign 0.00
R7218:C1qtnf6 UTSW 15 78527374 missense probably benign 0.00
R7317:C1qtnf6 UTSW 15 78525006 missense probably damaging 1.00
R7438:C1qtnf6 UTSW 15 78525374 missense probably benign
R8122:C1qtnf6 UTSW 15 78527246 missense probably benign 0.05
X0022:C1qtnf6 UTSW 15 78525035 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGACCTGCCCTGTTTTC -3'
(R):5'- GCCATGGCAGTGTTATCTGG -3'

Sequencing Primer
(F):5'- AAGACCTGCCCTGTTTTCTTCTG -3'
(R):5'- GGGGTGCTGAGACAAATGTATCTATC -3'
Posted On2019-10-07