Mutagenetix > Incidental Mutations

Incidental Mutation 'R7461:Setbp1'

578475

Institutional Source

Beutler Lab

Gene Symbol

Setbp1

Ensembl Gene

ENSMUSG00000024548

Gene Name

SET binding protein 1

Synonyms

Seb

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.718) question?

Stock #

R7461 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78750380-79109391 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 78856492 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Arginine at position 1320 (M1320R)

Ref Sequence

ENSEMBL: ENSMUSP00000025430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025430]

Predicted Effect

probably benign
Transcript: ENSMUST00000025430
AA Change: M1320R

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: M1320R

Domain	Start	End	E-Value	Type
low complexity region	155	165	N/A	INTRINSIC
low complexity region	221	251	N/A	INTRINSIC
low complexity region	278	286	N/A	INTRINSIC
AT_hook	528	540	4.64e-1	SMART
low complexity region	565	571	N/A	INTRINSIC
low complexity region	594	617	N/A	INTRINSIC
low complexity region	878	887	N/A	INTRINSIC
AT_hook	960	972	1.89e-1	SMART
low complexity region	1086	1103	N/A	INTRINSIC
low complexity region	1316	1337	N/A	INTRINSIC
AT_hook	1393	1405	7.27e-1	SMART
low complexity region	1462	1486	N/A	INTRINSIC
low complexity region	1498	1514	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adgrb2	CTATA	CTATATA	4: 130,021,213		probably benign	Het
Akt2	A	G	7: 27,637,170	I448V	probably benign	Het
Anapc5	G	A	5: 122,818,865	T117M	probably damaging	Het
Arhgap10	T	C	8: 77,388,697	E358G	probably damaging	Het
C1qtnf6	T	A	15: 78,527,349	K42N	probably benign	Het
Cacna1d	A	T	14: 30,066,163	D1605E	probably benign	Het
Cdkl1	T	A	12: 69,756,461	I214L	probably benign	Het
Celsr2	C	T	3: 108,395,640	G2506R	probably damaging	Het
Cenpj	G	A	14: 56,527,044	R1304*	probably null	Het
Cfap58	A	G	19: 47,982,122	D593G	possibly damaging	Het
Crip2	T	C	12: 113,144,157		probably null	Het
Crocc2	G	T	1: 93,194,589	A735S	possibly damaging	Het
Dcc	A	T	18: 71,306,034	L1279H	probably damaging	Het
Dnah2	A	G	11: 69,548,990		probably null	Het
Dpp8	C	T	9: 65,053,120	T311M	possibly damaging	Het
Eps15	T	C	4: 109,329,725	S330P	probably damaging	Het
Exoc2	C	T	13: 30,882,272	V474I	probably benign	Het
Fmn1	A	G	2: 113,364,071	T39A	unknown	Het
Foxn2	T	C	17: 88,486,883	I416T	possibly damaging	Het
Gbp8	T	C	5: 105,031,014	E145G	probably damaging	Het
Gjd2	A	C	2: 114,011,118	S293A	possibly damaging	Het
Gm3676	T	A	14: 41,643,276	I141L	probably benign	Het
Gm4131	A	G	14: 62,481,089	Y23H	possibly damaging	Het
Gm884	G	T	11: 103,616,290	H1617Q	unknown	Het
Gucy1b1	T	A	3: 82,039,747	D385V	possibly damaging	Het
Hdac2	T	C	10: 36,989,236	S149P	probably damaging	Het
Igsf9b	A	T	9: 27,334,122	R1128S	probably benign	Het
Invs	A	G	4: 48,392,668	H294R	probably damaging	Het
Itgbl1	T	A	14: 123,827,799	S122T	possibly damaging	Het
Kansl3	G	A	1: 36,343,795	S812F	probably damaging	Het
Kcnt1	A	T	2: 25,901,346	H567L	probably benign	Het
Klhl30	G	T	1: 91,357,408	V329F	possibly damaging	Het
Krt33a	A	G	11: 100,011,939	I353T	probably damaging	Het
Lrrc7	T	C	3: 158,187,020	T331A	probably benign	Het
Megf10	G	T	18: 57,252,853	V313F	probably damaging	Het
Myo15	A	G	11: 60,505,152	T1438A		Het
Myocd	A	G	11: 65,218,603	L114P	probably damaging	Het
Olfr1444	A	T	19: 12,861,777	M1L	probably benign	Het
Pde4b	A	G	4: 102,255,306	E29G	probably damaging	Het
Por	G	T	5: 135,729,504	A112S	probably damaging	Het
Prkcq	T	C	2: 11,299,410	F651S	probably damaging	Het
Selenoi	A	G	5: 30,266,928	I376V	possibly damaging	Het
Skint6	A	T	4: 113,177,046		probably null	Het
Tdrd6	T	C	17: 43,627,926	T744A	probably benign	Het
Tmem209	C	T	6: 30,508,470	W61*	probably null	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Top1	A	T	2: 160,712,842		probably null	Het
Tradd	T	C	8: 105,260,564	K37E	possibly damaging	Het
Ttc28	C	A	5: 111,224,129	L846M	probably damaging	Het
Umodl1	T	A	17: 30,988,057	C807*	probably null	Het
Upf2	T	A	2: 5,973,536	S404T	unknown	Het
Wscd1	T	C	11: 71,759,973	L42P	possibly damaging	Het

Other mutations in Setbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Setbp1	APN	18	78755679	nonsense	probably null	0.00
IGL00668:Setbp1	APN	18	78857770	missense	probably damaging	1.00
IGL01628:Setbp1	APN	18	78856777	missense	probably damaging	1.00
IGL02084:Setbp1	APN	18	78857410	missense	probably damaging	1.00
IGL02405:Setbp1	APN	18	78857299	missense	probably damaging	1.00
IGL02427:Setbp1	APN	18	78857473	missense	probably damaging	1.00
IGL02612:Setbp1	APN	18	78755710	missense	probably damaging	1.00
IGL02725:Setbp1	APN	18	78857374	nonsense	probably null
IGL03005:Setbp1	APN	18	78859125	missense	possibly damaging	0.75
IGL03123:Setbp1	APN	18	78857009	missense	probably damaging	1.00
R1083:Setbp1	UTSW	18	78857626	missense	probably damaging	1.00
R1110:Setbp1	UTSW	18	78857860	missense	probably damaging	1.00
R1167:Setbp1	UTSW	18	78857236	missense	possibly damaging	0.85
R1221:Setbp1	UTSW	18	78856583	missense	probably damaging	1.00
R1225:Setbp1	UTSW	18	78858208	missense	probably damaging	0.99
R1327:Setbp1	UTSW	18	78783358	missense	probably benign	0.00
R1481:Setbp1	UTSW	18	78783301	missense	probably benign	0.01
R1482:Setbp1	UTSW	18	79086835	missense	probably damaging	1.00
R1496:Setbp1	UTSW	18	78859912	missense	probably damaging	1.00
R1550:Setbp1	UTSW	18	78858592	missense	probably damaging	1.00
R1708:Setbp1	UTSW	18	78858467	missense	probably damaging	0.99
R1751:Setbp1	UTSW	18	78857398	missense	probably damaging	1.00
R1922:Setbp1	UTSW	18	78858362	missense	possibly damaging	0.75
R1986:Setbp1	UTSW	18	78858544	missense	probably damaging	0.99
R2090:Setbp1	UTSW	18	78856720	missense	probably benign	0.00
R2851:Setbp1	UTSW	18	78923996	missense	probably benign	0.11
R2853:Setbp1	UTSW	18	78923996	missense	probably benign	0.11
R2941:Setbp1	UTSW	18	78858197	missense	probably damaging	1.00
R3151:Setbp1	UTSW	18	78857435	missense	probably damaging	1.00
R3156:Setbp1	UTSW	18	78859303	missense	probably benign	0.00
R3807:Setbp1	UTSW	18	78783322	missense	probably benign	0.01
R4133:Setbp1	UTSW	18	78856991	missense	probably benign	0.05
R4287:Setbp1	UTSW	18	78859061	missense	probably benign	0.03
R4345:Setbp1	UTSW	18	79086579	missense	probably damaging	0.99
R4374:Setbp1	UTSW	18	78859922	missense	probably damaging	0.97
R4377:Setbp1	UTSW	18	78859922	missense	probably damaging	0.97
R4378:Setbp1	UTSW	18	78856618	missense	possibly damaging	0.95
R4379:Setbp1	UTSW	18	79086681	missense	probably damaging	1.00
R4585:Setbp1	UTSW	18	79086949	missense	probably benign	0.00
R4595:Setbp1	UTSW	18	78857516	missense	probably benign	0.00
R4817:Setbp1	UTSW	18	78858800	missense	probably damaging	1.00
R4971:Setbp1	UTSW	18	78858167	missense	probably benign	0.07
R4976:Setbp1	UTSW	18	79086712	missense	probably damaging	1.00
R5017:Setbp1	UTSW	18	78856594	missense	possibly damaging	0.81
R5066:Setbp1	UTSW	18	78857299	missense	probably damaging	1.00
R5133:Setbp1	UTSW	18	78857482	missense	probably damaging	1.00
R5151:Setbp1	UTSW	18	78857999	missense	probably damaging	1.00
R5237:Setbp1	UTSW	18	78856975	missense	possibly damaging	0.92
R5480:Setbp1	UTSW	18	78858063	missense	probably damaging	0.99
R5507:Setbp1	UTSW	18	79086712	missense	probably damaging	1.00
R5529:Setbp1	UTSW	18	79086652	missense	probably damaging	0.99
R5622:Setbp1	UTSW	18	78857485	missense	probably damaging	1.00
R5722:Setbp1	UTSW	18	78856645	missense	possibly damaging	0.95
R5806:Setbp1	UTSW	18	78856482	unclassified	probably null
R5940:Setbp1	UTSW	18	78755488	missense	probably damaging	1.00
R6025:Setbp1	UTSW	18	78859240	missense	probably damaging	0.98
R6030:Setbp1	UTSW	18	78857711	missense	probably benign	0.02
R6030:Setbp1	UTSW	18	78857711	missense	probably benign	0.02
R6250:Setbp1	UTSW	18	78858002	missense	probably benign	0.00
R6256:Setbp1	UTSW	18	78857257	missense	probably damaging	1.00
R6332:Setbp1	UTSW	18	78783369	missense	probably benign	0.21
R6522:Setbp1	UTSW	18	78857390	missense	probably damaging	0.98
R6873:Setbp1	UTSW	18	78859559	missense	probably benign	0.00
R6886:Setbp1	UTSW	18	78857500	missense	probably damaging	1.00
R6986:Setbp1	UTSW	18	78857839	missense	probably damaging	1.00
R7042:Setbp1	UTSW	18	79086855	missense	probably damaging	1.00
R7131:Setbp1	UTSW	18	79086960	missense	probably benign	0.08
R7134:Setbp1	UTSW	18	78859519	missense	possibly damaging	0.86
R7215:Setbp1	UTSW	18	78856837	missense	probably damaging	0.97
R7219:Setbp1	UTSW	18	78755745	missense	probably damaging	1.00
R7378:Setbp1	UTSW	18	78857486	missense	probably damaging	1.00
R7589:Setbp1	UTSW	18	78856492	missense	probably benign	0.01
R7840:Setbp1	UTSW	18	78783424	missense	probably benign	0.03
R7849:Setbp1	UTSW	18	78856853	missense	probably benign	0.00
R7923:Setbp1	UTSW	18	78783424	missense	probably benign	0.03
R7932:Setbp1	UTSW	18	78856853	missense	probably benign	0.00
Z1088:Setbp1	UTSW	18	78859594	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCATTGGCTTTGTGGAACAG -3'
(R):5'- TAAAAGGTACTCTGGCAGCGG -3'

Sequencing Primer
(F):5'- CAGAAAGACAGGCAAATCATGTAAAC -3'
(R):5'- TACTCTGGCAGCGGTGGAG -3'

Posted On

2019-10-07