Incidental Mutation 'R7461:Cfap58'
ID578478
Institutional Source Beutler Lab
Gene Symbol Cfap58
Ensembl Gene ENSMUSG00000046585
Gene Namecilia and flagella associated protein 58
SynonymsLOC381229, Ccdc147
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R7461 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location47937712-48035379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47982122 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 593 (D593G)
Ref Sequence ENSEMBL: ENSMUSP00000070533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066308]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066308
AA Change: D593G

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000070533
Gene: ENSMUSG00000046585
AA Change: D593G

DomainStartEndE-ValueType
coiled coil region 106 579 N/A INTRINSIC
coiled coil region 642 706 N/A INTRINSIC
low complexity region 740 762 N/A INTRINSIC
coiled coil region 772 832 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adgrb2 CTATA CTATATA 4: 130,021,213 probably benign Het
Akt2 A G 7: 27,637,170 I448V probably benign Het
Anapc5 G A 5: 122,818,865 T117M probably damaging Het
Arhgap10 T C 8: 77,388,697 E358G probably damaging Het
C1qtnf6 T A 15: 78,527,349 K42N probably benign Het
Cacna1d A T 14: 30,066,163 D1605E probably benign Het
Cdkl1 T A 12: 69,756,461 I214L probably benign Het
Celsr2 C T 3: 108,395,640 G2506R probably damaging Het
Cenpj G A 14: 56,527,044 R1304* probably null Het
Crip2 T C 12: 113,144,157 probably null Het
Crocc2 G T 1: 93,194,589 A735S possibly damaging Het
Dcc A T 18: 71,306,034 L1279H probably damaging Het
Dnah2 A G 11: 69,548,990 probably null Het
Dpp8 C T 9: 65,053,120 T311M possibly damaging Het
Eps15 T C 4: 109,329,725 S330P probably damaging Het
Exoc2 C T 13: 30,882,272 V474I probably benign Het
Fmn1 A G 2: 113,364,071 T39A unknown Het
Foxn2 T C 17: 88,486,883 I416T possibly damaging Het
Gbp8 T C 5: 105,031,014 E145G probably damaging Het
Gjd2 A C 2: 114,011,118 S293A possibly damaging Het
Gm3676 T A 14: 41,643,276 I141L probably benign Het
Gm4131 A G 14: 62,481,089 Y23H possibly damaging Het
Gm884 G T 11: 103,616,290 H1617Q unknown Het
Gucy1b1 T A 3: 82,039,747 D385V possibly damaging Het
Hdac2 T C 10: 36,989,236 S149P probably damaging Het
Igsf9b A T 9: 27,334,122 R1128S probably benign Het
Invs A G 4: 48,392,668 H294R probably damaging Het
Itgbl1 T A 14: 123,827,799 S122T possibly damaging Het
Kansl3 G A 1: 36,343,795 S812F probably damaging Het
Kcnt1 A T 2: 25,901,346 H567L probably benign Het
Klhl30 G T 1: 91,357,408 V329F possibly damaging Het
Krt33a A G 11: 100,011,939 I353T probably damaging Het
Lrrc7 T C 3: 158,187,020 T331A probably benign Het
Megf10 G T 18: 57,252,853 V313F probably damaging Het
Myo15 A G 11: 60,505,152 T1438A Het
Myocd A G 11: 65,218,603 L114P probably damaging Het
Olfr1444 A T 19: 12,861,777 M1L probably benign Het
Pde4b A G 4: 102,255,306 E29G probably damaging Het
Por G T 5: 135,729,504 A112S probably damaging Het
Prkcq T C 2: 11,299,410 F651S probably damaging Het
Selenoi A G 5: 30,266,928 I376V possibly damaging Het
Setbp1 A C 18: 78,856,492 M1320R probably benign Het
Skint6 A T 4: 113,177,046 probably null Het
Tdrd6 T C 17: 43,627,926 T744A probably benign Het
Tmem209 C T 6: 30,508,470 W61* probably null Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Top1 A T 2: 160,712,842 probably null Het
Tradd T C 8: 105,260,564 K37E possibly damaging Het
Ttc28 C A 5: 111,224,129 L846M probably damaging Het
Umodl1 T A 17: 30,988,057 C807* probably null Het
Upf2 T A 2: 5,973,536 S404T unknown Het
Wscd1 T C 11: 71,759,973 L42P possibly damaging Het
Other mutations in Cfap58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:Cfap58 APN 19 47974567 missense probably benign 0.30
IGL02068:Cfap58 APN 19 47986512 missense probably damaging 1.00
IGL02609:Cfap58 APN 19 47975502 missense possibly damaging 0.80
IGL03376:Cfap58 APN 19 48034725 missense possibly damaging 0.60
PIT4515001:Cfap58 UTSW 19 48034683 missense probably benign
PIT4618001:Cfap58 UTSW 19 47975514 missense probably damaging 1.00
R0015:Cfap58 UTSW 19 48029100 missense probably benign 0.45
R0015:Cfap58 UTSW 19 48029100 missense probably benign 0.45
R0454:Cfap58 UTSW 19 47974680 critical splice donor site probably null
R0545:Cfap58 UTSW 19 47941097 splice site probably benign
R0789:Cfap58 UTSW 19 47955309 missense probably benign 0.09
R0926:Cfap58 UTSW 19 47962562 missense probably damaging 0.96
R1148:Cfap58 UTSW 19 47988504 missense probably damaging 0.96
R1148:Cfap58 UTSW 19 47988504 missense probably damaging 0.96
R1462:Cfap58 UTSW 19 47962430 missense probably damaging 1.00
R1462:Cfap58 UTSW 19 47962430 missense probably damaging 1.00
R1493:Cfap58 UTSW 19 47988504 missense probably damaging 0.96
R1541:Cfap58 UTSW 19 47983530 missense probably damaging 1.00
R1629:Cfap58 UTSW 19 47941339 missense probably benign 0.02
R1648:Cfap58 UTSW 19 47955405 missense probably benign 0.13
R1837:Cfap58 UTSW 19 48029139 missense probably damaging 0.98
R2307:Cfap58 UTSW 19 47962486 nonsense probably null
R2513:Cfap58 UTSW 19 47962542 missense probably benign 0.03
R3802:Cfap58 UTSW 19 47953059 missense possibly damaging 0.81
R4233:Cfap58 UTSW 19 47975555 missense possibly damaging 0.60
R4258:Cfap58 UTSW 19 47949484 splice site probably null
R4414:Cfap58 UTSW 19 47953041 missense possibly damaging 0.87
R4763:Cfap58 UTSW 19 47983506 missense probably damaging 1.00
R5300:Cfap58 UTSW 19 47941156 missense probably benign 0.09
R5406:Cfap58 UTSW 19 48029102 missense possibly damaging 0.81
R5497:Cfap58 UTSW 19 48029109 missense probably benign 0.08
R5635:Cfap58 UTSW 19 47983542 missense possibly damaging 0.47
R6315:Cfap58 UTSW 19 47941277 missense probably benign 0.40
R6483:Cfap58 UTSW 19 47983452 missense probably benign 0.00
R6727:Cfap58 UTSW 19 47955417 missense probably benign 0.30
R6896:Cfap58 UTSW 19 47944187 missense probably damaging 0.98
R7473:Cfap58 UTSW 19 47974625 nonsense probably null
R7613:Cfap58 UTSW 19 47982122 missense possibly damaging 0.70
R7650:Cfap58 UTSW 19 47986528 missense possibly damaging 0.84
R7982:Cfap58 UTSW 19 47974567 missense probably benign 0.30
R8083:Cfap58 UTSW 19 47983518 missense probably damaging 1.00
R8121:Cfap58 UTSW 19 48029104 missense probably benign 0.40
R8321:Cfap58 UTSW 19 47958147 missense probably damaging 0.99
R8396:Cfap58 UTSW 19 48029101 missense probably damaging 1.00
R8462:Cfap58 UTSW 19 47983650 missense possibly damaging 0.94
R8745:Cfap58 UTSW 19 47941114 nonsense probably null
R8805:Cfap58 UTSW 19 47953096 missense not run
X0067:Cfap58 UTSW 19 47955308 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGAATTCTGCTAAATGAGACACG -3'
(R):5'- GCTCCTGACTGAGTGGAATG -3'

Sequencing Primer
(F):5'- TTCTGCTAAATGAGACACGAGACG -3'
(R):5'- AATGGGTGACTACTTTCCTGTCAG -3'
Posted On2019-10-07