Incidental Mutation 'R7462:Lhx6'
ID578485
Institutional Source Beutler Lab
Gene Symbol Lhx6
Ensembl Gene ENSMUSG00000026890
Gene NameLIM homeobox protein 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.845) question?
Stock #R7462 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location36081953-36105408 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36084071 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 359 (I359T)
Ref Sequence ENSEMBL: ENSMUSP00000108585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028256] [ENSMUST00000112960] [ENSMUST00000112961] [ENSMUST00000112963] [ENSMUST00000112966] [ENSMUST00000112967] [ENSMUST00000136821] [ENSMUST00000148852]
Predicted Effect probably benign
Transcript: ENSMUST00000028256
SMART Domains Protein: ENSMUSP00000028256
Gene: ENSMUSG00000026894

DomainStartEndE-ValueType
MORN 6 27 1.24e1 SMART
MORN 29 50 3.61e-2 SMART
Pfam:MORN 54 75 2e-4 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112960
AA Change: I388T

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108584
Gene: ENSMUSG00000026890
AA Change: I388T

DomainStartEndE-ValueType
low complexity region 71 94 N/A INTRINSIC
LIM 98 151 7.34e-13 SMART
LIM 159 213 3.17e-17 SMART
HOX 248 310 1.1e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112961
AA Change: I359T

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108585
Gene: ENSMUSG00000026890
AA Change: I359T

DomainStartEndE-ValueType
low complexity region 42 65 N/A INTRINSIC
LIM 69 122 7.34e-13 SMART
LIM 130 184 3.17e-17 SMART
HOX 219 281 1.1e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112963
AA Change: I359T

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108587
Gene: ENSMUSG00000026890
AA Change: I359T

DomainStartEndE-ValueType
low complexity region 42 65 N/A INTRINSIC
LIM 69 122 7.34e-13 SMART
LIM 130 184 3.17e-17 SMART
HOX 219 281 1.1e-23 SMART
Predicted Effect silent
Transcript: ENSMUST00000112966
SMART Domains Protein: ENSMUSP00000108590
Gene: ENSMUSG00000026890

DomainStartEndE-ValueType
low complexity region 42 65 N/A INTRINSIC
LIM 69 122 7.34e-13 SMART
LIM 130 184 3.17e-17 SMART
HOX 219 281 1.1e-23 SMART
Predicted Effect silent
Transcript: ENSMUST00000112967
SMART Domains Protein: ENSMUSP00000108591
Gene: ENSMUSG00000026890

DomainStartEndE-ValueType
low complexity region 71 94 N/A INTRINSIC
LIM 98 151 7.34e-13 SMART
LIM 159 213 3.17e-17 SMART
HOX 248 310 1.1e-23 SMART
Predicted Effect silent
Transcript: ENSMUST00000136821
SMART Domains Protein: ENSMUSP00000135776
Gene: ENSMUSG00000026890

DomainStartEndE-ValueType
LIM 10 64 3.17e-17 SMART
Predicted Effect silent
Transcript: ENSMUST00000148852
SMART Domains Protein: ENSMUSP00000135693
Gene: ENSMUSG00000026890

DomainStartEndE-ValueType
low complexity region 42 65 N/A INTRINSIC
LIM 69 122 7.34e-13 SMART
LIM 130 184 3.17e-17 SMART
HOX 219 281 1.1e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large protein family that contains the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein has tandem LIM domains as well as a DNA-binding homeodomain. The protein functions as a transcription factor involved in embryogenesis and head development and is highly expressed in neural crest derived mesenchyme cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutation of this gene results in impaired migration and specification of cortical interneurons, postnatal lethality and weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 G C 3: 126,943,034 T3067S unknown Het
Ankrd28 T C 14: 31,778,929 N35S probably benign Het
Bicra A T 7: 15,979,135 S996T possibly damaging Het
Btbd7 T C 12: 102,837,722 E353G possibly damaging Het
Ccdc144b T A 3: 36,025,906 probably null Het
Cdhr2 A T 13: 54,726,739 I875F probably damaging Het
Ceacam5 A T 7: 17,760,839 Y924F probably damaging Het
Clca4b A G 3: 144,922,860 I362T probably benign Het
Dchs2 A G 3: 83,346,155 probably null Het
Dlc1 T A 8: 36,937,964 T224S unknown Het
Dmxl2 T C 9: 54,366,632 probably null Het
Dnajc1 A G 2: 18,308,899 F137S probably damaging Het
E130311K13Rik T C 3: 63,929,301 T24A probably benign Het
Eya1 T C 1: 14,231,414 E317G probably null Het
Fpr-rs6 A G 17: 20,182,223 L292P probably damaging Het
Gca G T 2: 62,672,409 D54Y possibly damaging Het
Gm45861 G A 8: 27,534,489 probably null Het
Gm9573 T C 17: 35,620,676 S873G unknown Het
Gtf2a1l A G 17: 88,694,138 T141A possibly damaging Het
Hgsnat T C 8: 25,957,213 N351S probably benign Het
Htr1f A T 16: 64,926,020 V303E probably damaging Het
Iars2 C A 1: 185,322,866 W302L probably damaging Het
Igkv4-74 T A 6: 69,185,116 Q23L possibly damaging Het
Il18 A T 9: 50,565,373 probably benign Het
Ints4 A G 7: 97,506,128 D329G probably benign Het
Itsn1 T C 16: 91,853,185 F249S possibly damaging Het
Ktn1 A G 14: 47,694,632 E672G probably null Het
Lrp1b T C 2: 41,113,029 E2030G Het
Macf1 T A 4: 123,492,763 K1114N probably damaging Het
Mbd5 A G 2: 49,257,880 M701V possibly damaging Het
Mcemp1 A T 8: 3,667,065 M69L probably benign Het
Mfsd4b2 T A 10: 39,921,881 K159N probably benign Het
Mroh2b T A 15: 4,908,627 D243E probably damaging Het
Mug1 A T 6: 121,875,440 Q829L probably benign Het
Nav3 A T 10: 109,823,578 V726E probably damaging Het
Nfib T C 4: 82,353,589 Q247R probably benign Het
Npbwr1 T C 1: 5,916,932 N121S probably damaging Het
Olfr187 A T 16: 59,036,016 C240* probably null Het
Olfr378 T C 11: 73,425,470 D171G probably benign Het
Olfr691 T A 7: 105,337,500 D72V probably damaging Het
Pkd1l3 A G 8: 109,628,777 S726G probably benign Het
Ppip5k1 A T 2: 121,336,751 V847D probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Ripor2 G A 13: 24,696,307 V385M unknown Het
Rufy1 C T 11: 50,407,828 V379M possibly damaging Het
S100a5 A G 3: 90,609,900 K26R probably damaging Het
Sin3a T C 9: 57,095,525 S234P probably benign Het
Sirt7 G A 11: 120,620,792 T225I probably benign Het
Slc17a2 A T 13: 23,822,418 T476S probably damaging Het
Slc38a6 T A 12: 73,350,577 M331K probably benign Het
Spam1 T C 6: 24,796,908 I286T probably damaging Het
Syne1 T A 10: 5,052,793 I214F possibly damaging Het
Tmtc1 A G 6: 148,325,145 L427P probably damaging Het
Tpbg G A 9: 85,844,850 A291T possibly damaging Het
Zfp40 A G 17: 23,178,388 F45S possibly damaging Het
Zfp451 C T 1: 33,777,013 V619M probably damaging Het
Zim1 A G 7: 6,677,812 L284P probably damaging Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Zmynd11 T A 13: 9,698,684 N154Y probably benign Het
Zscan12 A T 13: 21,369,287 H427L possibly damaging Het
Other mutations in Lhx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Lhx6 APN 2 36091716 splice site probably benign
IGL01391:Lhx6 APN 2 36103465 missense probably benign 0.00
IGL01413:Lhx6 APN 2 36103516 missense probably benign 0.24
IGL03154:Lhx6 APN 2 36094443 splice site probably null
R1546:Lhx6 UTSW 2 36091037 missense probably benign 0.00
R1630:Lhx6 UTSW 2 36102901 missense probably damaging 1.00
R1785:Lhx6 UTSW 2 36087458 nonsense probably null
R1786:Lhx6 UTSW 2 36087458 nonsense probably null
R1792:Lhx6 UTSW 2 36087375 missense probably damaging 1.00
R2126:Lhx6 UTSW 2 36091324 missense possibly damaging 0.94
R2145:Lhx6 UTSW 2 36087466 missense probably benign 0.01
R2167:Lhx6 UTSW 2 36103359 missense probably damaging 1.00
R2393:Lhx6 UTSW 2 36091390 missense probably benign 0.22
R5102:Lhx6 UTSW 2 36094210 splice site probably null
R5418:Lhx6 UTSW 2 36087366 critical splice donor site probably null
R6735:Lhx6 UTSW 2 36091378 missense probably damaging 0.99
R7546:Lhx6 UTSW 2 36103345 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GATGCCACATTTCAGGGAGC -3'
(R):5'- CTGCTCTTGCTATGAGAGATCAC -3'

Sequencing Primer
(F):5'- GACTCTGCTGCTCCTGGTG -3'
(R):5'- TTTACACATGAGGAAACAGGCTTG -3'
Posted On2019-10-07