Incidental Mutation 'R7462:Mbd5'
ID578487
Institutional Source Beutler Lab
Gene Symbol Mbd5
Ensembl Gene ENSMUSG00000036792
Gene Namemethyl-CpG binding domain protein 5
SynonymsC030040A15Rik, OTTMUSG00000012483, 9430004D19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7462 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location48949508-49325405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49257880 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 701 (M701V)
Ref Sequence ENSEMBL: ENSMUSP00000036847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047413] [ENSMUST00000112745] [ENSMUST00000112754]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047413
AA Change: M701V

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036847
Gene: ENSMUSG00000036792
AA Change: M701V

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 9e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 912 932 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
low complexity region 992 1010 N/A INTRINSIC
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1112 1136 N/A INTRINSIC
low complexity region 1173 1184 N/A INTRINSIC
low complexity region 1206 1229 N/A INTRINSIC
low complexity region 1552 1562 N/A INTRINSIC
SCOP:d1khca_ 1615 1718 2e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112745
AA Change: M701V

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108365
Gene: ENSMUSG00000036792
AA Change: M701V

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 4e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112754
AA Change: M701V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000108374
Gene: ENSMUSG00000036792
AA Change: M701V

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 8e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 912 932 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
low complexity region 976 999 N/A INTRINSIC
low complexity region 1322 1332 N/A INTRINSIC
SCOP:d1khca_ 1385 1488 4e-17 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000119317
Gene: ENSMUSG00000036792
AA Change: M440V

DomainStartEndE-ValueType
low complexity region 72 82 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
low complexity region 199 207 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 275 286 N/A INTRINSIC
low complexity region 311 353 N/A INTRINSIC
low complexity region 439 459 N/A INTRINSIC
low complexity region 581 592 N/A INTRINSIC
low complexity region 652 672 N/A INTRINSIC
low complexity region 674 688 N/A INTRINSIC
low complexity region 732 750 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 852 876 N/A INTRINSIC
low complexity region 913 924 N/A INTRINSIC
low complexity region 946 969 N/A INTRINSIC
low complexity region 1011 1022 N/A INTRINSIC
low complexity region 1056 1064 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199257
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the methyl-CpG-binding domain (MBD) family. The MBD consists of about 70 residues and is the minimal region required for a methyl-CpG-binding protein binding specifically to methylated DNA. In addition to the MBD domain, this protein contains a PWWP domain (Pro-Trp-Trp-Pro motif), which consists of 100-150 amino acids and is found in numerous proteins that are involved in cell division, growth and differentiation. Mutations in this gene cause mental retardation autosomal dominant type 1. Haploinsufficiency of this gene is associated with a syndrome involving microcephaly, intellectual disabilities, severe speech impairment, and seizures. Alternatively spliced transcript variants have been found, but their full-length nature is not determined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozgyous for a knock-out allele exhibit severe postnatal growth retardation leading to lethality by P22, decreased body, brain and liver weights, reduced IGF-I and GH levels, and abnormal glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 G C 3: 126,943,034 T3067S unknown Het
Ankrd28 T C 14: 31,778,929 N35S probably benign Het
Bicra A T 7: 15,979,135 S996T possibly damaging Het
Btbd7 T C 12: 102,837,722 E353G possibly damaging Het
Ccdc144b T A 3: 36,025,906 probably null Het
Cdhr2 A T 13: 54,726,739 I875F probably damaging Het
Ceacam5 A T 7: 17,760,839 Y924F probably damaging Het
Clca4b A G 3: 144,922,860 I362T probably benign Het
Dchs2 A G 3: 83,346,155 probably null Het
Dlc1 T A 8: 36,937,964 T224S unknown Het
Dmxl2 T C 9: 54,366,632 probably null Het
Dnajc1 A G 2: 18,308,899 F137S probably damaging Het
E130311K13Rik T C 3: 63,929,301 T24A probably benign Het
Eya1 T C 1: 14,231,414 E317G probably null Het
Fpr-rs6 A G 17: 20,182,223 L292P probably damaging Het
Gca G T 2: 62,672,409 D54Y possibly damaging Het
Gm45861 G A 8: 27,534,489 probably null Het
Gm9573 T C 17: 35,620,676 S873G unknown Het
Gtf2a1l A G 17: 88,694,138 T141A possibly damaging Het
Hgsnat T C 8: 25,957,213 N351S probably benign Het
Htr1f A T 16: 64,926,020 V303E probably damaging Het
Iars2 C A 1: 185,322,866 W302L probably damaging Het
Igkv4-74 T A 6: 69,185,116 Q23L possibly damaging Het
Il18 A T 9: 50,565,373 probably benign Het
Ints4 A G 7: 97,506,128 D329G probably benign Het
Itsn1 T C 16: 91,853,185 F249S possibly damaging Het
Ktn1 A G 14: 47,694,632 E672G probably null Het
Lhx6 A G 2: 36,084,071 I359T possibly damaging Het
Lrp1b T C 2: 41,113,029 E2030G Het
Macf1 T A 4: 123,492,763 K1114N probably damaging Het
Mcemp1 A T 8: 3,667,065 M69L probably benign Het
Mfsd4b2 T A 10: 39,921,881 K159N probably benign Het
Mroh2b T A 15: 4,908,627 D243E probably damaging Het
Mug1 A T 6: 121,875,440 Q829L probably benign Het
Nav3 A T 10: 109,823,578 V726E probably damaging Het
Nfib T C 4: 82,353,589 Q247R probably benign Het
Npbwr1 T C 1: 5,916,932 N121S probably damaging Het
Olfr187 A T 16: 59,036,016 C240* probably null Het
Olfr378 T C 11: 73,425,470 D171G probably benign Het
Olfr691 T A 7: 105,337,500 D72V probably damaging Het
Pkd1l3 A G 8: 109,628,777 S726G probably benign Het
Ppip5k1 A T 2: 121,336,751 V847D probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Ripor2 G A 13: 24,696,307 V385M unknown Het
Rufy1 C T 11: 50,407,828 V379M possibly damaging Het
S100a5 A G 3: 90,609,900 K26R probably damaging Het
Sin3a T C 9: 57,095,525 S234P probably benign Het
Sirt7 G A 11: 120,620,792 T225I probably benign Het
Slc17a2 A T 13: 23,822,418 T476S probably damaging Het
Slc38a6 T A 12: 73,350,577 M331K probably benign Het
Spam1 T C 6: 24,796,908 I286T probably damaging Het
Syne1 T A 10: 5,052,793 I214F possibly damaging Het
Tmtc1 A G 6: 148,325,145 L427P probably damaging Het
Tpbg G A 9: 85,844,850 A291T possibly damaging Het
Zfp40 A G 17: 23,178,388 F45S possibly damaging Het
Zfp451 C T 1: 33,777,013 V619M probably damaging Het
Zim1 A G 7: 6,677,812 L284P probably damaging Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Zmynd11 T A 13: 9,698,684 N154Y probably benign Het
Zscan12 A T 13: 21,369,287 H427L possibly damaging Het
Other mutations in Mbd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Mbd5 APN 2 49250221 missense possibly damaging 0.92
IGL01481:Mbd5 APN 2 49278939 missense possibly damaging 0.90
IGL01639:Mbd5 APN 2 49272308 missense probably damaging 0.98
IGL02063:Mbd5 APN 2 49274767 missense probably damaging 1.00
IGL02157:Mbd5 APN 2 49278975 missense probably benign
IGL02510:Mbd5 APN 2 49257029 missense probably benign 0.05
IGL02932:Mbd5 APN 2 49279448 missense possibly damaging 0.66
IGL02973:Mbd5 APN 2 49313709 missense probably damaging 0.99
IGL03189:Mbd5 APN 2 49257751 missense probably damaging 0.98
F5770:Mbd5 UTSW 2 49316410 missense probably damaging 0.99
R0391:Mbd5 UTSW 2 49272416 missense possibly damaging 0.90
R0427:Mbd5 UTSW 2 49279079 missense probably benign 0.27
R0544:Mbd5 UTSW 2 49257209 missense possibly damaging 0.54
R0883:Mbd5 UTSW 2 49256689 missense possibly damaging 0.94
R1072:Mbd5 UTSW 2 49257191 missense probably damaging 1.00
R1099:Mbd5 UTSW 2 49258144 missense probably benign 0.06
R1400:Mbd5 UTSW 2 49274776 critical splice donor site probably null
R1497:Mbd5 UTSW 2 49257381 missense possibly damaging 0.73
R1552:Mbd5 UTSW 2 49272934 missense probably damaging 0.99
R1675:Mbd5 UTSW 2 49256218 missense possibly damaging 0.90
R1710:Mbd5 UTSW 2 49257032 missense probably benign 0.10
R2085:Mbd5 UTSW 2 49279311 missense possibly damaging 0.90
R2252:Mbd5 UTSW 2 49257686 missense probably damaging 1.00
R2473:Mbd5 UTSW 2 49279341 missense probably benign 0.06
R3966:Mbd5 UTSW 2 49272070 missense possibly damaging 0.46
R4278:Mbd5 UTSW 2 49272293 missense probably damaging 0.97
R4348:Mbd5 UTSW 2 49256327 missense probably benign
R4366:Mbd5 UTSW 2 49272966 missense probably damaging 0.99
R4428:Mbd5 UTSW 2 49279764 missense possibly damaging 0.94
R4556:Mbd5 UTSW 2 49279394 missense probably damaging 1.00
R4600:Mbd5 UTSW 2 49257197 missense probably benign 0.31
R4689:Mbd5 UTSW 2 49258279 missense possibly damaging 0.46
R4707:Mbd5 UTSW 2 49250156 missense probably damaging 0.99
R4718:Mbd5 UTSW 2 49256402 missense possibly damaging 0.66
R4773:Mbd5 UTSW 2 49274611 missense probably damaging 1.00
R4846:Mbd5 UTSW 2 49256997 missense probably damaging 1.00
R5015:Mbd5 UTSW 2 49258196 missense possibly damaging 0.92
R5059:Mbd5 UTSW 2 49256455 missense probably damaging 0.96
R5268:Mbd5 UTSW 2 49272094 missense possibly damaging 0.92
R5479:Mbd5 UTSW 2 49272905 missense probably damaging 0.99
R5579:Mbd5 UTSW 2 49272814 missense possibly damaging 0.94
R5591:Mbd5 UTSW 2 49274669 missense probably damaging 1.00
R5876:Mbd5 UTSW 2 49274645 missense probably damaging 0.98
R5886:Mbd5 UTSW 2 49272452 missense probably damaging 1.00
R5973:Mbd5 UTSW 2 49272389 missense probably benign 0.23
R6935:Mbd5 UTSW 2 49279812 missense probably damaging 0.97
R7317:Mbd5 UTSW 2 49279743 missense probably benign
R7366:Mbd5 UTSW 2 49274568 missense probably benign
R7385:Mbd5 UTSW 2 49272449 missense probably benign 0.01
R7402:Mbd5 UTSW 2 49257554 missense probably damaging 1.00
R7549:Mbd5 UTSW 2 49251343 missense probably damaging 0.97
V7583:Mbd5 UTSW 2 49316410 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCAACTGCCAACATGCTTC -3'
(R):5'- AAAGGTATGCTCTGTGTCAGTG -3'

Sequencing Primer
(F):5'- TTCTCCCAACAGGTGAAGGTC -3'
(R):5'- CTCTGTGTCAGTGAATTCTGAAGAAC -3'
Posted On2019-10-07