Incidental Mutation 'R7462:Bicra'
ID578501
Institutional Source Beutler Lab
Gene Symbol Bicra
Ensembl Gene ENSMUSG00000070808
Gene NameBRD4 interacting chromatin remodeling complex associated protein
SynonymsGltscr1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R7462 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location15970672-16047921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15979135 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 996 (S996T)
Ref Sequence ENSEMBL: ENSMUSP00000092416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094821] [ENSMUST00000210781]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094821
AA Change: S996T

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092416
Gene: ENSMUSG00000070808
AA Change: S996T

DomainStartEndE-ValueType
low complexity region 86 96 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
internal_repeat_1 156 298 1.03e-6 PROSPERO
low complexity region 308 323 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
internal_repeat_1 479 614 1.03e-6 PROSPERO
low complexity region 619 638 N/A INTRINSIC
low complexity region 642 676 N/A INTRINSIC
low complexity region 719 732 N/A INTRINSIC
low complexity region 756 782 N/A INTRINSIC
low complexity region 790 819 N/A INTRINSIC
low complexity region 827 843 N/A INTRINSIC
low complexity region 852 906 N/A INTRINSIC
low complexity region 940 950 N/A INTRINSIC
low complexity region 987 1006 N/A INTRINSIC
Pfam:GLTSCR1 1094 1202 4.6e-43 PFAM
low complexity region 1232 1251 N/A INTRINSIC
low complexity region 1275 1294 N/A INTRINSIC
low complexity region 1349 1371 N/A INTRINSIC
low complexity region 1460 1473 N/A INTRINSIC
low complexity region 1535 1555 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000210781
AA Change: S996T

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 G C 3: 126,943,034 T3067S unknown Het
Ankrd28 T C 14: 31,778,929 N35S probably benign Het
Btbd7 T C 12: 102,837,722 E353G possibly damaging Het
Ccdc144b T A 3: 36,025,906 probably null Het
Cdhr2 A T 13: 54,726,739 I875F probably damaging Het
Ceacam5 A T 7: 17,760,839 Y924F probably damaging Het
Clca4b A G 3: 144,922,860 I362T probably benign Het
Dchs2 A G 3: 83,346,155 probably null Het
Dlc1 T A 8: 36,937,964 T224S unknown Het
Dmxl2 T C 9: 54,366,632 probably null Het
Dnajc1 A G 2: 18,308,899 F137S probably damaging Het
E130311K13Rik T C 3: 63,929,301 T24A probably benign Het
Eya1 T C 1: 14,231,414 E317G probably null Het
Fpr-rs6 A G 17: 20,182,223 L292P probably damaging Het
Gca G T 2: 62,672,409 D54Y possibly damaging Het
Gm45861 G A 8: 27,534,489 probably null Het
Gm9573 T C 17: 35,620,676 S873G unknown Het
Gtf2a1l A G 17: 88,694,138 T141A possibly damaging Het
Hgsnat T C 8: 25,957,213 N351S probably benign Het
Htr1f A T 16: 64,926,020 V303E probably damaging Het
Iars2 C A 1: 185,322,866 W302L probably damaging Het
Igkv4-74 T A 6: 69,185,116 Q23L possibly damaging Het
Il18 A T 9: 50,565,373 probably benign Het
Ints4 A G 7: 97,506,128 D329G probably benign Het
Itsn1 T C 16: 91,853,185 F249S possibly damaging Het
Ktn1 A G 14: 47,694,632 E672G probably null Het
Lhx6 A G 2: 36,084,071 I359T possibly damaging Het
Lrp1b T C 2: 41,113,029 E2030G Het
Macf1 T A 4: 123,492,763 K1114N probably damaging Het
Mbd5 A G 2: 49,257,880 M701V possibly damaging Het
Mcemp1 A T 8: 3,667,065 M69L probably benign Het
Mfsd4b2 T A 10: 39,921,881 K159N probably benign Het
Mroh2b T A 15: 4,908,627 D243E probably damaging Het
Mug1 A T 6: 121,875,440 Q829L probably benign Het
Nav3 A T 10: 109,823,578 V726E probably damaging Het
Nfib T C 4: 82,353,589 Q247R probably benign Het
Npbwr1 T C 1: 5,916,932 N121S probably damaging Het
Olfr187 A T 16: 59,036,016 C240* probably null Het
Olfr378 T C 11: 73,425,470 D171G probably benign Het
Olfr691 T A 7: 105,337,500 D72V probably damaging Het
Pkd1l3 A G 8: 109,628,777 S726G probably benign Het
Ppip5k1 A T 2: 121,336,751 V847D probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Ripor2 G A 13: 24,696,307 V385M unknown Het
Rufy1 C T 11: 50,407,828 V379M possibly damaging Het
S100a5 A G 3: 90,609,900 K26R probably damaging Het
Sin3a T C 9: 57,095,525 S234P probably benign Het
Sirt7 G A 11: 120,620,792 T225I probably benign Het
Slc17a2 A T 13: 23,822,418 T476S probably damaging Het
Slc38a6 T A 12: 73,350,577 M331K probably benign Het
Spam1 T C 6: 24,796,908 I286T probably damaging Het
Syne1 T A 10: 5,052,793 I214F possibly damaging Het
Tmtc1 A G 6: 148,325,145 L427P probably damaging Het
Tpbg G A 9: 85,844,850 A291T possibly damaging Het
Zfp40 A G 17: 23,178,388 F45S possibly damaging Het
Zfp451 C T 1: 33,777,013 V619M probably damaging Het
Zim1 A G 7: 6,677,812 L284P probably damaging Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Zmynd11 T A 13: 9,698,684 N154Y probably benign Het
Zscan12 A T 13: 21,369,287 H427L possibly damaging Het
Other mutations in Bicra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Bicra APN 7 15996577 missense possibly damaging 0.70
IGL01521:Bicra APN 7 15989188 missense probably benign 0.18
IGL01690:Bicra APN 7 15987753 missense probably benign 0.09
IGL01721:Bicra APN 7 15988699 missense probably benign
IGL01994:Bicra APN 7 15972816 missense possibly damaging 0.46
IGL02084:Bicra APN 7 15987738 missense probably benign 0.09
IGL02312:Bicra APN 7 15993141 missense possibly damaging 0.85
IGL02686:Bicra APN 7 15987915 missense probably benign 0.02
IGL02727:Bicra APN 7 15979465 missense possibly damaging 0.95
IGL03031:Bicra APN 7 15975801 missense probably benign 0.16
R0003:Bicra UTSW 7 15971887 missense probably benign
R0025:Bicra UTSW 7 15987511 missense possibly damaging 0.53
R0241:Bicra UTSW 7 15975145 missense probably damaging 1.00
R0241:Bicra UTSW 7 15975145 missense probably damaging 1.00
R0417:Bicra UTSW 7 15972322 missense probably damaging 1.00
R0437:Bicra UTSW 7 15988762 missense possibly damaging 0.73
R0547:Bicra UTSW 7 15972248 missense probably damaging 1.00
R0688:Bicra UTSW 7 15989322 missense probably damaging 1.00
R0855:Bicra UTSW 7 15972004 missense probably damaging 1.00
R1448:Bicra UTSW 7 15988359 missense possibly damaging 0.86
R1637:Bicra UTSW 7 15972689 missense probably benign 0.19
R1899:Bicra UTSW 7 15987751 missense possibly damaging 0.53
R2035:Bicra UTSW 7 15996413 missense possibly damaging 0.53
R2247:Bicra UTSW 7 15989234 missense probably benign 0.33
R2471:Bicra UTSW 7 15972332 missense probably benign 0.04
R2484:Bicra UTSW 7 15988680 missense possibly damaging 0.96
R3437:Bicra UTSW 7 15989298 missense possibly damaging 0.85
R3551:Bicra UTSW 7 15979733 missense probably benign 0.33
R4816:Bicra UTSW 7 15988906 missense possibly damaging 0.53
R4901:Bicra UTSW 7 15987601 missense possibly damaging 0.53
R5035:Bicra UTSW 7 15979424 missense possibly damaging 0.90
R5078:Bicra UTSW 7 15975457 missense probably damaging 1.00
R5094:Bicra UTSW 7 15975371 missense probably damaging 1.00
R5195:Bicra UTSW 7 15979953 missense possibly damaging 0.93
R5496:Bicra UTSW 7 15987841 missense probably benign 0.33
R5780:Bicra UTSW 7 15979754 missense possibly damaging 0.96
R6541:Bicra UTSW 7 15979129 missense probably benign 0.00
R6560:Bicra UTSW 7 15989194 missense possibly damaging 0.53
R6575:Bicra UTSW 7 15979131 missense probably benign 0.25
R6854:Bicra UTSW 7 15988762 missense probably benign 0.18
R6967:Bicra UTSW 7 15972205 missense probably damaging 0.97
R7283:Bicra UTSW 7 15972500 missense probably damaging 1.00
R7454:Bicra UTSW 7 15972134 missense probably benign 0.30
R7488:Bicra UTSW 7 15989442 critical splice acceptor site probably null
R7506:Bicra UTSW 7 15988213 missense possibly damaging 0.96
R7534:Bicra UTSW 7 15971935 missense probably damaging 0.98
X0064:Bicra UTSW 7 15975775 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTACCAGCAGAGTAGGG -3'
(R):5'- GATTCCACCAGGTAACCATCAG -3'

Sequencing Primer
(F):5'- TACCAGCAGAGTAGGGGGACAC -3'
(R):5'- AGGTAACCATCAGCAGCG -3'
Posted On2019-10-07