Incidental Mutation 'R7462:Ceacam5'
ID578502
Institutional Source Beutler Lab
Gene Symbol Ceacam5
Ensembl Gene ENSMUSG00000008789
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 5
SynonymsPsg30, 1600029H12Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7462 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location17713238-17761132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17760839 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 924 (Y924F)
Ref Sequence ENSEMBL: ENSMUSP00000080582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081907]
Predicted Effect probably damaging
Transcript: ENSMUST00000081907
AA Change: Y924F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080582
Gene: ENSMUSG00000008789
AA Change: Y924F

DomainStartEndE-ValueType
IG 40 141 4.46e-1 SMART
IG_like 160 261 2.96e1 SMART
IG_like 277 378 5.86e0 SMART
IG_like 397 496 4.07e1 SMART
IG 514 615 2.64e0 SMART
IG_like 634 735 2.81e1 SMART
IG 753 853 1.72e-2 SMART
IGc2 869 933 1.28e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 G C 3: 126,943,034 T3067S unknown Het
Ankrd28 T C 14: 31,778,929 N35S probably benign Het
Bicra A T 7: 15,979,135 S996T possibly damaging Het
Btbd7 T C 12: 102,837,722 E353G possibly damaging Het
Ccdc144b T A 3: 36,025,906 probably null Het
Cdhr2 A T 13: 54,726,739 I875F probably damaging Het
Clca4b A G 3: 144,922,860 I362T probably benign Het
Dchs2 A G 3: 83,346,155 probably null Het
Dlc1 T A 8: 36,937,964 T224S unknown Het
Dmxl2 T C 9: 54,366,632 probably null Het
Dnajc1 A G 2: 18,308,899 F137S probably damaging Het
E130311K13Rik T C 3: 63,929,301 T24A probably benign Het
Eya1 T C 1: 14,231,414 E317G probably null Het
Fpr-rs6 A G 17: 20,182,223 L292P probably damaging Het
Gca G T 2: 62,672,409 D54Y possibly damaging Het
Gm45861 G A 8: 27,534,489 probably null Het
Gm9573 T C 17: 35,620,676 S873G unknown Het
Gtf2a1l A G 17: 88,694,138 T141A possibly damaging Het
Hgsnat T C 8: 25,957,213 N351S probably benign Het
Htr1f A T 16: 64,926,020 V303E probably damaging Het
Iars2 C A 1: 185,322,866 W302L probably damaging Het
Igkv4-74 T A 6: 69,185,116 Q23L possibly damaging Het
Il18 A T 9: 50,565,373 probably benign Het
Ints4 A G 7: 97,506,128 D329G probably benign Het
Itsn1 T C 16: 91,853,185 F249S possibly damaging Het
Ktn1 A G 14: 47,694,632 E672G probably null Het
Lhx6 A G 2: 36,084,071 I359T possibly damaging Het
Lrp1b T C 2: 41,113,029 E2030G Het
Macf1 T A 4: 123,492,763 K1114N probably damaging Het
Mbd5 A G 2: 49,257,880 M701V possibly damaging Het
Mcemp1 A T 8: 3,667,065 M69L probably benign Het
Mfsd4b2 T A 10: 39,921,881 K159N probably benign Het
Mroh2b T A 15: 4,908,627 D243E probably damaging Het
Mug1 A T 6: 121,875,440 Q829L probably benign Het
Nav3 A T 10: 109,823,578 V726E probably damaging Het
Nfib T C 4: 82,353,589 Q247R probably benign Het
Npbwr1 T C 1: 5,916,932 N121S probably damaging Het
Olfr187 A T 16: 59,036,016 C240* probably null Het
Olfr378 T C 11: 73,425,470 D171G probably benign Het
Olfr691 T A 7: 105,337,500 D72V probably damaging Het
Pkd1l3 A G 8: 109,628,777 S726G probably benign Het
Ppip5k1 A T 2: 121,336,751 V847D probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Ripor2 G A 13: 24,696,307 V385M unknown Het
Rufy1 C T 11: 50,407,828 V379M possibly damaging Het
S100a5 A G 3: 90,609,900 K26R probably damaging Het
Sin3a T C 9: 57,095,525 S234P probably benign Het
Sirt7 G A 11: 120,620,792 T225I probably benign Het
Slc17a2 A T 13: 23,822,418 T476S probably damaging Het
Slc38a6 T A 12: 73,350,577 M331K probably benign Het
Spam1 T C 6: 24,796,908 I286T probably damaging Het
Syne1 T A 10: 5,052,793 I214F possibly damaging Het
Tmtc1 A G 6: 148,325,145 L427P probably damaging Het
Tpbg G A 9: 85,844,850 A291T possibly damaging Het
Zfp40 A G 17: 23,178,388 F45S possibly damaging Het
Zfp451 C T 1: 33,777,013 V619M probably damaging Het
Zim1 A G 7: 6,677,812 L284P probably damaging Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Zmynd11 T A 13: 9,698,684 N154Y probably benign Het
Zscan12 A T 13: 21,369,287 H427L possibly damaging Het
Other mutations in Ceacam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Ceacam5 APN 7 17759556 nonsense probably null
IGL00981:Ceacam5 APN 7 17745533 missense probably benign 0.08
IGL01314:Ceacam5 APN 7 17747256 nonsense probably null
IGL01329:Ceacam5 APN 7 17745609 missense probably damaging 0.98
IGL01389:Ceacam5 APN 7 17747375 missense probably damaging 0.96
IGL01418:Ceacam5 APN 7 17745599 missense probably damaging 1.00
IGL02418:Ceacam5 APN 7 17759434 missense possibly damaging 0.71
IGL02734:Ceacam5 APN 7 17750812 missense probably damaging 1.00
IGL03220:Ceacam5 APN 7 17760728 missense probably damaging 1.00
IGL03377:Ceacam5 APN 7 17715131 missense probably benign 0.15
IGL03395:Ceacam5 APN 7 17745379 splice site probably benign
IGL03054:Ceacam5 UTSW 7 17759454 missense possibly damaging 0.71
R0456:Ceacam5 UTSW 7 17760851 missense possibly damaging 0.63
R0624:Ceacam5 UTSW 7 17714963 missense probably benign 0.03
R0847:Ceacam5 UTSW 7 17757837 missense possibly damaging 0.71
R0879:Ceacam5 UTSW 7 17757702 missense probably benign 0.16
R0945:Ceacam5 UTSW 7 17747344 missense probably damaging 1.00
R1382:Ceacam5 UTSW 7 17752165 missense probably benign 0.33
R1474:Ceacam5 UTSW 7 17747234 missense probably damaging 1.00
R1526:Ceacam5 UTSW 7 17750695 missense probably damaging 1.00
R1793:Ceacam5 UTSW 7 17747395 missense probably benign 0.01
R1851:Ceacam5 UTSW 7 17714910 nonsense probably null
R1907:Ceacam5 UTSW 7 17752384 missense possibly damaging 0.85
R1913:Ceacam5 UTSW 7 17759577 nonsense probably null
R1990:Ceacam5 UTSW 7 17757880 missense probably damaging 0.99
R1999:Ceacam5 UTSW 7 17747247 missense possibly damaging 0.66
R2336:Ceacam5 UTSW 7 17747375 missense probably benign 0.28
R2355:Ceacam5 UTSW 7 17745635 missense probably damaging 1.00
R3106:Ceacam5 UTSW 7 17747323 missense probably benign 0.06
R3423:Ceacam5 UTSW 7 17757637 missense possibly damaging 0.52
R3432:Ceacam5 UTSW 7 17714976 missense probably benign 0.06
R3686:Ceacam5 UTSW 7 17760823 missense possibly damaging 0.94
R3713:Ceacam5 UTSW 7 17759338 missense possibly damaging 0.52
R3878:Ceacam5 UTSW 7 17750581 missense probably damaging 1.00
R4214:Ceacam5 UTSW 7 17752151 missense probably benign 0.00
R4335:Ceacam5 UTSW 7 17752129 missense probably benign
R4725:Ceacam5 UTSW 7 17760677 missense probably benign 0.26
R4823:Ceacam5 UTSW 7 17757744 missense possibly damaging 0.71
R4833:Ceacam5 UTSW 7 17752258 missense probably benign
R4986:Ceacam5 UTSW 7 17757833 missense possibly damaging 0.85
R5099:Ceacam5 UTSW 7 17745588 missense probably damaging 0.96
R5365:Ceacam5 UTSW 7 17759548 missense probably damaging 0.98
R5522:Ceacam5 UTSW 7 17715080 missense probably benign
R5605:Ceacam5 UTSW 7 17747236 missense probably benign 0.03
R6199:Ceacam5 UTSW 7 17714885 missense probably benign 0.00
R6222:Ceacam5 UTSW 7 17745547 missense probably benign 0.15
R6320:Ceacam5 UTSW 7 17747198 missense probably damaging 1.00
R6464:Ceacam5 UTSW 7 17747466 critical splice donor site probably null
R6521:Ceacam5 UTSW 7 17750831 critical splice donor site probably null
R6568:Ceacam5 UTSW 7 17745491 missense probably damaging 1.00
R6573:Ceacam5 UTSW 7 17713447 start codon destroyed probably null 0.70
R6814:Ceacam5 UTSW 7 17752287 nonsense probably null
R6872:Ceacam5 UTSW 7 17752287 nonsense probably null
R6930:Ceacam5 UTSW 7 17750834 splice site probably null
R7071:Ceacam5 UTSW 7 17750652 missense possibly damaging 0.49
R7121:Ceacam5 UTSW 7 17745537 missense probably benign 0.29
R7174:Ceacam5 UTSW 7 17757914 critical splice donor site probably null
R7187:Ceacam5 UTSW 7 17759485 missense possibly damaging 0.85
R7355:Ceacam5 UTSW 7 17747387 missense probably damaging 1.00
R7411:Ceacam5 UTSW 7 17750753 missense probably damaging 0.99
R7612:Ceacam5 UTSW 7 17759416 missense possibly damaging 0.86
R7803:Ceacam5 UTSW 7 17759392 missense probably damaging 0.98
X0020:Ceacam5 UTSW 7 17760909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGACCCTGTTTCATGGC -3'
(R):5'- AAGGCAGTACTTGAGTGGTAACTG -3'

Sequencing Primer
(F):5'- CCTTTTGTGCGAGTGACTGAC -3'
(R):5'- CAGTACTTGAGTGGTAACTGACAAC -3'
Posted On2019-10-07