Incidental Mutation 'R7462:Hgsnat'
ID578506
Institutional Source Beutler Lab
Gene Symbol Hgsnat
Ensembl Gene ENSMUSG00000037260
Gene Nameheparan-alpha-glucosaminide N-acetyltransferase
SynonymsD8Ertd354e, 9430010M12Rik, Tmem76
Accession Numbers

Ncbi RefSeq: NM_029884.1; MGI:1196297

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7462 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location25944453-25976753 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25957213 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 351 (N351S)
Ref Sequence ENSEMBL: ENSMUSP00000040356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037609]
Predicted Effect probably benign
Transcript: ENSMUST00000037609
AA Change: N351S

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040356
Gene: ENSMUSG00000037260
AA Change: N351S

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
Pfam:DUF1624 260 434 6.8e-11 PFAM
Pfam:DUF5009 286 389 2.4e-10 PFAM
transmembrane domain 494 516 N/A INTRINSIC
transmembrane domain 523 545 N/A INTRINSIC
transmembrane domain 560 582 N/A INTRINSIC
transmembrane domain 587 609 N/A INTRINSIC
transmembrane domain 629 648 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal acetyltransferase, which is one of several enzymes involved in the lysosomal degradation of heparin sulfate. Mutations in this gene are associated with Sanfilippo syndrome C, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit progressive storage pathology in the CNS and peripheral organs, glycosaminoglycan accumulation in brain and most somatic organs, lysosomal distension and dysfunction, astrocytosis, microgliosis, hepatosplenomegaly, behavioral deficits and premature death. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(3) Gene trapped(6)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 G C 3: 126,943,034 T3067S unknown Het
Ankrd28 T C 14: 31,778,929 N35S probably benign Het
Bicra A T 7: 15,979,135 S996T possibly damaging Het
Btbd7 T C 12: 102,837,722 E353G possibly damaging Het
Ccdc144b T A 3: 36,025,906 probably null Het
Cdhr2 A T 13: 54,726,739 I875F probably damaging Het
Ceacam5 A T 7: 17,760,839 Y924F probably damaging Het
Clca4b A G 3: 144,922,860 I362T probably benign Het
Dchs2 A G 3: 83,346,155 probably null Het
Dlc1 T A 8: 36,937,964 T224S unknown Het
Dmxl2 T C 9: 54,366,632 probably null Het
Dnajc1 A G 2: 18,308,899 F137S probably damaging Het
E130311K13Rik T C 3: 63,929,301 T24A probably benign Het
Eya1 T C 1: 14,231,414 E317G probably null Het
Fpr-rs6 A G 17: 20,182,223 L292P probably damaging Het
Gca G T 2: 62,672,409 D54Y possibly damaging Het
Gm45861 G A 8: 27,534,489 probably null Het
Gm9573 T C 17: 35,620,676 S873G unknown Het
Gtf2a1l A G 17: 88,694,138 T141A possibly damaging Het
Htr1f A T 16: 64,926,020 V303E probably damaging Het
Iars2 C A 1: 185,322,866 W302L probably damaging Het
Igkv4-74 T A 6: 69,185,116 Q23L possibly damaging Het
Il18 A T 9: 50,565,373 probably benign Het
Ints4 A G 7: 97,506,128 D329G probably benign Het
Itsn1 T C 16: 91,853,185 F249S possibly damaging Het
Ktn1 A G 14: 47,694,632 E672G probably null Het
Lhx6 A G 2: 36,084,071 I359T possibly damaging Het
Lrp1b T C 2: 41,113,029 E2030G Het
Macf1 T A 4: 123,492,763 K1114N probably damaging Het
Mbd5 A G 2: 49,257,880 M701V possibly damaging Het
Mcemp1 A T 8: 3,667,065 M69L probably benign Het
Mfsd4b2 T A 10: 39,921,881 K159N probably benign Het
Mroh2b T A 15: 4,908,627 D243E probably damaging Het
Mug1 A T 6: 121,875,440 Q829L probably benign Het
Nav3 A T 10: 109,823,578 V726E probably damaging Het
Nfib T C 4: 82,353,589 Q247R probably benign Het
Npbwr1 T C 1: 5,916,932 N121S probably damaging Het
Olfr187 A T 16: 59,036,016 C240* probably null Het
Olfr378 T C 11: 73,425,470 D171G probably benign Het
Olfr691 T A 7: 105,337,500 D72V probably damaging Het
Pkd1l3 A G 8: 109,628,777 S726G probably benign Het
Ppip5k1 A T 2: 121,336,751 V847D probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Ripor2 G A 13: 24,696,307 V385M unknown Het
Rufy1 C T 11: 50,407,828 V379M possibly damaging Het
S100a5 A G 3: 90,609,900 K26R probably damaging Het
Sin3a T C 9: 57,095,525 S234P probably benign Het
Sirt7 G A 11: 120,620,792 T225I probably benign Het
Slc17a2 A T 13: 23,822,418 T476S probably damaging Het
Slc38a6 T A 12: 73,350,577 M331K probably benign Het
Spam1 T C 6: 24,796,908 I286T probably damaging Het
Syne1 T A 10: 5,052,793 I214F possibly damaging Het
Tmtc1 A G 6: 148,325,145 L427P probably damaging Het
Tpbg G A 9: 85,844,850 A291T possibly damaging Het
Zfp40 A G 17: 23,178,388 F45S possibly damaging Het
Zfp451 C T 1: 33,777,013 V619M probably damaging Het
Zim1 A G 7: 6,677,812 L284P probably damaging Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Zmynd11 T A 13: 9,698,684 N154Y probably benign Het
Zscan12 A T 13: 21,369,287 H427L possibly damaging Het
Other mutations in Hgsnat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Hgsnat APN 8 25972937 missense probably benign 0.04
IGL02950:Hgsnat APN 8 25971701 missense probably damaging 1.00
IGL03145:Hgsnat APN 8 25946452 missense probably damaging 1.00
ample UTSW 8 25947960 nonsense probably null
generous UTSW 8 25968361 critical splice donor site probably null
P0018:Hgsnat UTSW 8 25968354 unclassified probably benign
PIT4305001:Hgsnat UTSW 8 25945199 missense possibly damaging 0.67
R1396:Hgsnat UTSW 8 25957335 missense possibly damaging 0.95
R1676:Hgsnat UTSW 8 25954605 critical splice donor site probably null
R1856:Hgsnat UTSW 8 25957256 missense probably benign 0.06
R1998:Hgsnat UTSW 8 25945252 nonsense probably null
R2497:Hgsnat UTSW 8 25945252 nonsense probably null
R2570:Hgsnat UTSW 8 25945252 nonsense probably null
R4012:Hgsnat UTSW 8 25955789 nonsense probably null
R4080:Hgsnat UTSW 8 25946343 missense probably benign 0.02
R4462:Hgsnat UTSW 8 25954636 missense probably damaging 1.00
R4523:Hgsnat UTSW 8 25968361 critical splice donor site probably null
R4914:Hgsnat UTSW 8 25964838 missense probably damaging 0.98
R5010:Hgsnat UTSW 8 25947960 nonsense probably null
R5561:Hgsnat UTSW 8 25946334 missense possibly damaging 0.90
R5889:Hgsnat UTSW 8 25963367 missense probably damaging 1.00
R6411:Hgsnat UTSW 8 25946275 missense possibly damaging 0.88
R6520:Hgsnat UTSW 8 25953300 missense probably damaging 1.00
R6524:Hgsnat UTSW 8 25945232 missense probably damaging 1.00
R7230:Hgsnat UTSW 8 25954832 intron probably null
R7509:Hgsnat UTSW 8 25955726 missense probably damaging 0.98
R7526:Hgsnat UTSW 8 25971049 missense probably damaging 1.00
R7583:Hgsnat UTSW 8 25971564 critical splice donor site probably null
R7679:Hgsnat UTSW 8 25954637 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCGGAAGAACTCCATCAGAG -3'
(R):5'- AGTGGACAGATGGTGTGTCAC -3'

Sequencing Primer
(F):5'- CAAAACGTTTGCTGAGCATGTGC -3'
(R):5'- GTGTCACCTCCCTCCCGTATTATAAG -3'
Posted On2019-10-07