Incidental Mutation 'R7462:Dlc1'
ID578508
Institutional Source Beutler Lab
Gene Symbol Dlc1
Ensembl Gene ENSMUSG00000031523
Gene Namedeleted in liver cancer 1
SynonymsArhgap7, A730069N07Rik, STARD12, p122-RhoGAP
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7462 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location36567751-36953143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36937964 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 224 (T224S)
Ref Sequence ENSEMBL: ENSMUSP00000132812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163663] [ENSMUST00000179501]
Predicted Effect unknown
Transcript: ENSMUST00000163663
AA Change: T224S
SMART Domains Protein: ENSMUSP00000132812
Gene: ENSMUSG00000031523
AA Change: T224S

DomainStartEndE-ValueType
low complexity region 353 369 N/A INTRINSIC
low complexity region 388 403 N/A INTRINSIC
Pfam:SAM_2 466 527 1.2e-7 PFAM
low complexity region 605 625 N/A INTRINSIC
low complexity region 689 701 N/A INTRINSIC
low complexity region 749 776 N/A INTRINSIC
low complexity region 878 892 N/A INTRINSIC
RhoGAP 1104 1296 8.82e-59 SMART
START 1338 1539 3.93e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179501
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP) that is a member of the rhoGAP family of proteins which play a role in the regulation of small GTP-binding proteins. GAP family proteins participate in signaling pathways that regulate cell processes involved in cytoskeletal changes. This gene functions as a tumor suppressor gene in a number of common cancers, including prostate, lung, colorectal, and breast cancers. Multiple transcript variants due to alternative promoters and alternative splicing have been found for this gene.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous mutants die by E10.5 with variable defects in the neural tube, heart, brain and placenta. Mouse embryonic fibroblasts homozygous for an activated conditional allele exhibti increased sensitivity to Ras-induced transformation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 G C 3: 126,943,034 T3067S unknown Het
Ankrd28 T C 14: 31,778,929 N35S probably benign Het
Bicra A T 7: 15,979,135 S996T possibly damaging Het
Btbd7 T C 12: 102,837,722 E353G possibly damaging Het
Ccdc144b T A 3: 36,025,906 probably null Het
Cdhr2 A T 13: 54,726,739 I875F probably damaging Het
Ceacam5 A T 7: 17,760,839 Y924F probably damaging Het
Clca4b A G 3: 144,922,860 I362T probably benign Het
Dchs2 A G 3: 83,346,155 probably null Het
Dmxl2 T C 9: 54,366,632 probably null Het
Dnajc1 A G 2: 18,308,899 F137S probably damaging Het
E130311K13Rik T C 3: 63,929,301 T24A probably benign Het
Eya1 T C 1: 14,231,414 E317G probably null Het
Fpr-rs6 A G 17: 20,182,223 L292P probably damaging Het
Gca G T 2: 62,672,409 D54Y possibly damaging Het
Gm45861 G A 8: 27,534,489 probably null Het
Gm9573 T C 17: 35,620,676 S873G unknown Het
Gtf2a1l A G 17: 88,694,138 T141A possibly damaging Het
Hgsnat T C 8: 25,957,213 N351S probably benign Het
Htr1f A T 16: 64,926,020 V303E probably damaging Het
Iars2 C A 1: 185,322,866 W302L probably damaging Het
Igkv4-74 T A 6: 69,185,116 Q23L possibly damaging Het
Il18 A T 9: 50,565,373 probably benign Het
Ints4 A G 7: 97,506,128 D329G probably benign Het
Itsn1 T C 16: 91,853,185 F249S possibly damaging Het
Ktn1 A G 14: 47,694,632 E672G probably null Het
Lhx6 A G 2: 36,084,071 I359T possibly damaging Het
Lrp1b T C 2: 41,113,029 E2030G Het
Macf1 T A 4: 123,492,763 K1114N probably damaging Het
Mbd5 A G 2: 49,257,880 M701V possibly damaging Het
Mcemp1 A T 8: 3,667,065 M69L probably benign Het
Mfsd4b2 T A 10: 39,921,881 K159N probably benign Het
Mroh2b T A 15: 4,908,627 D243E probably damaging Het
Mug1 A T 6: 121,875,440 Q829L probably benign Het
Nav3 A T 10: 109,823,578 V726E probably damaging Het
Nfib T C 4: 82,353,589 Q247R probably benign Het
Npbwr1 T C 1: 5,916,932 N121S probably damaging Het
Olfr187 A T 16: 59,036,016 C240* probably null Het
Olfr378 T C 11: 73,425,470 D171G probably benign Het
Olfr691 T A 7: 105,337,500 D72V probably damaging Het
Pkd1l3 A G 8: 109,628,777 S726G probably benign Het
Ppip5k1 A T 2: 121,336,751 V847D probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Ripor2 G A 13: 24,696,307 V385M unknown Het
Rufy1 C T 11: 50,407,828 V379M possibly damaging Het
S100a5 A G 3: 90,609,900 K26R probably damaging Het
Sin3a T C 9: 57,095,525 S234P probably benign Het
Sirt7 G A 11: 120,620,792 T225I probably benign Het
Slc17a2 A T 13: 23,822,418 T476S probably damaging Het
Slc38a6 T A 12: 73,350,577 M331K probably benign Het
Spam1 T C 6: 24,796,908 I286T probably damaging Het
Syne1 T A 10: 5,052,793 I214F possibly damaging Het
Tmtc1 A G 6: 148,325,145 L427P probably damaging Het
Tpbg G A 9: 85,844,850 A291T possibly damaging Het
Zfp40 A G 17: 23,178,388 F45S possibly damaging Het
Zfp451 C T 1: 33,777,013 V619M probably damaging Het
Zim1 A G 7: 6,677,812 L284P probably damaging Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Zmynd11 T A 13: 9,698,684 N154Y probably benign Het
Zscan12 A T 13: 21,369,287 H427L possibly damaging Het
Other mutations in Dlc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Dlc1 APN 8 36570282 utr 3 prime probably benign
IGL00807:Dlc1 APN 8 36572848 missense probably benign 0.01
IGL00924:Dlc1 APN 8 36938214 missense probably benign
IGL01349:Dlc1 APN 8 36583824 missense probably damaging 0.96
IGL01419:Dlc1 APN 8 36850217 missense probably benign 0.02
IGL01871:Dlc1 APN 8 36850180 missense probably damaging 0.99
IGL01937:Dlc1 APN 8 36850191 missense probably benign 0.25
IGL02525:Dlc1 APN 8 36579646 missense probably damaging 1.00
IGL02696:Dlc1 APN 8 36574172 missense possibly damaging 0.65
IGL02826:Dlc1 APN 8 36570275 utr 3 prime probably benign
IGL03029:Dlc1 APN 8 36571262 splice site probably null
IGL02835:Dlc1 UTSW 8 36583901 missense probably damaging 1.00
R0068:Dlc1 UTSW 8 36937721 missense probably benign
R0068:Dlc1 UTSW 8 36937721 missense probably benign
R0164:Dlc1 UTSW 8 36599440 missense probably damaging 0.96
R0164:Dlc1 UTSW 8 36599440 missense probably damaging 0.96
R0218:Dlc1 UTSW 8 36850229 missense probably benign
R0419:Dlc1 UTSW 8 36583586 missense possibly damaging 0.69
R0513:Dlc1 UTSW 8 36584010 missense probably damaging 1.00
R0645:Dlc1 UTSW 8 36574049 missense possibly damaging 0.60
R0646:Dlc1 UTSW 8 36858051 missense probably benign
R0727:Dlc1 UTSW 8 36572674 missense probably damaging 0.99
R0792:Dlc1 UTSW 8 36938548 missense probably benign 0.00
R1061:Dlc1 UTSW 8 36858051 missense probably benign
R1221:Dlc1 UTSW 8 36584831 missense probably benign
R1440:Dlc1 UTSW 8 36593463 splice site probably benign
R1501:Dlc1 UTSW 8 36938148 missense probably benign 0.06
R1606:Dlc1 UTSW 8 36850252 missense probably benign
R1707:Dlc1 UTSW 8 36937609 missense probably benign 0.03
R1750:Dlc1 UTSW 8 36858090 splice site probably null
R1762:Dlc1 UTSW 8 36937585 missense probably benign 0.25
R2041:Dlc1 UTSW 8 36582768 missense probably damaging 1.00
R2055:Dlc1 UTSW 8 36593381 missense probably damaging 0.98
R2091:Dlc1 UTSW 8 36937609 missense probably benign 0.00
R2987:Dlc1 UTSW 8 36574152 missense probably damaging 0.97
R4285:Dlc1 UTSW 8 36574128 missense possibly damaging 0.49
R4294:Dlc1 UTSW 8 36584753 missense possibly damaging 0.47
R4631:Dlc1 UTSW 8 36937558 critical splice donor site probably null
R4828:Dlc1 UTSW 8 36850246 missense possibly damaging 0.69
R4867:Dlc1 UTSW 8 36584645 missense probably benign 0.01
R4902:Dlc1 UTSW 8 36577131 missense probably damaging 1.00
R5067:Dlc1 UTSW 8 36584493 missense probably benign 0.04
R5068:Dlc1 UTSW 8 36938030 missense probably benign
R5198:Dlc1 UTSW 8 36938398 missense probably damaging 1.00
R5471:Dlc1 UTSW 8 36584725 missense probably benign 0.26
R5668:Dlc1 UTSW 8 36937501 unclassified probably benign
R5915:Dlc1 UTSW 8 36938675 utr 5 prime probably benign
R6323:Dlc1 UTSW 8 36938383 missense possibly damaging 0.62
R6655:Dlc1 UTSW 8 36572716 missense probably damaging 1.00
R6908:Dlc1 UTSW 8 36937687 missense probably benign 0.02
R6914:Dlc1 UTSW 8 36938210 missense probably benign
R6942:Dlc1 UTSW 8 36938210 missense probably benign
R7269:Dlc1 UTSW 8 36579253 missense probably damaging 1.00
R7271:Dlc1 UTSW 8 36582800 missense probably damaging 0.99
R7548:Dlc1 UTSW 8 36584655 missense probably benign 0.00
R7649:Dlc1 UTSW 8 36582740 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGCCCTCTGTCTACATAAG -3'
(R):5'- TGTCCACCATGCAAAGTAGC -3'

Sequencing Primer
(F):5'- CATAAGGAGCTGCTAAGACGTCTTC -3'
(R):5'- TTCTCATAACACCTGGAGGATGGC -3'
Posted On2019-10-07