Incidental Mutation 'R7462:Il18'
ID578510
Institutional Source Beutler Lab
Gene Symbol Il18
Ensembl Gene ENSMUSG00000039217
Gene Nameinterleukin 18
SynonymsIl-18, Igif
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7462 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location50554827-50581840 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 50565373 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034568] [ENSMUST00000213916] [ENSMUST00000214117] [ENSMUST00000217236]
Predicted Effect probably benign
Transcript: ENSMUST00000034568
SMART Domains Protein: ENSMUSP00000034568
Gene: ENSMUSG00000032065

DomainStartEndE-ValueType
Pfam:TEX12 28 122 2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213916
Predicted Effect probably benign
Transcript: ENSMUST00000214117
Predicted Effect probably benign
Transcript: ENSMUST00000217236
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a proinflammatory cytokine that augments natural killer cell activity in spleen cells, and stimulates interferon gamma production in T-helper type I cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for null alleles are deficient in producing IFN-gamma in response to infectious agents and have other impairments of the immune system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 G C 3: 126,943,034 T3067S unknown Het
Ankrd28 T C 14: 31,778,929 N35S probably benign Het
Bicra A T 7: 15,979,135 S996T possibly damaging Het
Btbd7 T C 12: 102,837,722 E353G possibly damaging Het
Ccdc144b T A 3: 36,025,906 probably null Het
Cdhr2 A T 13: 54,726,739 I875F probably damaging Het
Ceacam5 A T 7: 17,760,839 Y924F probably damaging Het
Clca4b A G 3: 144,922,860 I362T probably benign Het
Dchs2 A G 3: 83,346,155 probably null Het
Dlc1 T A 8: 36,937,964 T224S unknown Het
Dmxl2 T C 9: 54,366,632 probably null Het
Dnajc1 A G 2: 18,308,899 F137S probably damaging Het
E130311K13Rik T C 3: 63,929,301 T24A probably benign Het
Eya1 T C 1: 14,231,414 E317G probably null Het
Fpr-rs6 A G 17: 20,182,223 L292P probably damaging Het
Gca G T 2: 62,672,409 D54Y possibly damaging Het
Gm45861 G A 8: 27,534,489 probably null Het
Gm9573 T C 17: 35,620,676 S873G unknown Het
Gtf2a1l A G 17: 88,694,138 T141A possibly damaging Het
Hgsnat T C 8: 25,957,213 N351S probably benign Het
Htr1f A T 16: 64,926,020 V303E probably damaging Het
Iars2 C A 1: 185,322,866 W302L probably damaging Het
Igkv4-74 T A 6: 69,185,116 Q23L possibly damaging Het
Ints4 A G 7: 97,506,128 D329G probably benign Het
Itsn1 T C 16: 91,853,185 F249S possibly damaging Het
Ktn1 A G 14: 47,694,632 E672G probably null Het
Lhx6 A G 2: 36,084,071 I359T possibly damaging Het
Lrp1b T C 2: 41,113,029 E2030G Het
Macf1 T A 4: 123,492,763 K1114N probably damaging Het
Mbd5 A G 2: 49,257,880 M701V possibly damaging Het
Mcemp1 A T 8: 3,667,065 M69L probably benign Het
Mfsd4b2 T A 10: 39,921,881 K159N probably benign Het
Mroh2b T A 15: 4,908,627 D243E probably damaging Het
Mug1 A T 6: 121,875,440 Q829L probably benign Het
Nav3 A T 10: 109,823,578 V726E probably damaging Het
Nfib T C 4: 82,353,589 Q247R probably benign Het
Npbwr1 T C 1: 5,916,932 N121S probably damaging Het
Olfr187 A T 16: 59,036,016 C240* probably null Het
Olfr378 T C 11: 73,425,470 D171G probably benign Het
Olfr691 T A 7: 105,337,500 D72V probably damaging Het
Pkd1l3 A G 8: 109,628,777 S726G probably benign Het
Ppip5k1 A T 2: 121,336,751 V847D probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Ripor2 G A 13: 24,696,307 V385M unknown Het
Rufy1 C T 11: 50,407,828 V379M possibly damaging Het
S100a5 A G 3: 90,609,900 K26R probably damaging Het
Sin3a T C 9: 57,095,525 S234P probably benign Het
Sirt7 G A 11: 120,620,792 T225I probably benign Het
Slc17a2 A T 13: 23,822,418 T476S probably damaging Het
Slc38a6 T A 12: 73,350,577 M331K probably benign Het
Spam1 T C 6: 24,796,908 I286T probably damaging Het
Syne1 T A 10: 5,052,793 I214F possibly damaging Het
Tmtc1 A G 6: 148,325,145 L427P probably damaging Het
Tpbg G A 9: 85,844,850 A291T possibly damaging Het
Zfp40 A G 17: 23,178,388 F45S possibly damaging Het
Zfp451 C T 1: 33,777,013 V619M probably damaging Het
Zim1 A G 7: 6,677,812 L284P probably damaging Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Zmynd11 T A 13: 9,698,684 N154Y probably benign Het
Zscan12 A T 13: 21,369,287 H427L possibly damaging Het
Other mutations in Il18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Il18 APN 9 50579329 missense probably damaging 1.00
IGL02258:Il18 APN 9 50576703 missense probably benign 0.00
R0091:Il18 UTSW 9 50576713 splice site probably benign
R0355:Il18 UTSW 9 50579275 splice site probably benign
R0504:Il18 UTSW 9 50575328 missense probably damaging 0.99
R2295:Il18 UTSW 9 50579335 missense probably benign 0.33
R4162:Il18 UTSW 9 50579412 missense probably damaging 1.00
R5117:Il18 UTSW 9 50581509 missense possibly damaging 0.72
R5160:Il18 UTSW 9 50577893 critical splice donor site probably null
R7361:Il18 UTSW 9 50579314 missense probably damaging 1.00
R7522:Il18 UTSW 9 50575340 missense probably damaging 1.00
R7654:Il18 UTSW 9 50579401 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CTGGCTTTCTGAAAGAGGCATG -3'
(R):5'- CCAGTGTGCCCGAATAAAGAG -3'

Sequencing Primer
(F):5'- GCATGGTCCCAGCTTTTACAGAAG -3'
(R):5'- GAGAGACACATCTTACCTGGGC -3'
Posted On2019-10-07