Incidental Mutation 'R7462:Sin3a'
ID578511
Institutional Source Beutler Lab
Gene Symbol Sin3a
Ensembl Gene ENSMUSG00000042557
Gene Nametranscriptional regulator, SIN3A (yeast)
SynonymsSin3, mSin3A
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7462 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location57072040-57128366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57095525 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 234 (S234P)
Ref Sequence ENSEMBL: ENSMUSP00000130221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049169] [ENSMUST00000163400] [ENSMUST00000167715] [ENSMUST00000168177] [ENSMUST00000168502] [ENSMUST00000168678]
Predicted Effect probably benign
Transcript: ENSMUST00000049169
AA Change: S234P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045044
Gene: ENSMUSG00000042557
AA Change: S234P

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163400
SMART Domains Protein: ENSMUSP00000126718
Gene: ENSMUSG00000042557

DomainStartEndE-ValueType
Pfam:PAH 82 128 2.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167715
AA Change: S234P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130641
Gene: ENSMUSG00000042557
AA Change: S234P

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168177
AA Change: S234P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130221
Gene: ENSMUSG00000042557
AA Change: S234P

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 142 186 5.3e-22 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 323 380 9.6e-22 PFAM
Pfam:PAH 479 523 8.1e-11 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
Pfam:Sin3a_C 887 1190 1.2e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168502
AA Change: S234P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128956
Gene: ENSMUSG00000042557
AA Change: S234P

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1138 1154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168678
AA Change: S234P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126601
Gene: ENSMUSG00000042557
AA Change: S234P

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Meta Mutation Damage Score 0.0575 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulatory protein. It contains paired amphipathic helix (PAH) domains, which are important for protein-protein interactions and may mediate repression by the Mad-Max complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in early embryonic lethality. Homozygous null MEFs display poor cell proliferation, reduced S-phase and increased G2/M fractions, a block in DNA replication, and enhanced apoptosis; however, no increase in chromosomal instability is observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 G C 3: 126,943,034 T3067S unknown Het
Ankrd28 T C 14: 31,778,929 N35S probably benign Het
Bicra A T 7: 15,979,135 S996T possibly damaging Het
Btbd7 T C 12: 102,837,722 E353G possibly damaging Het
Ccdc144b T A 3: 36,025,906 probably null Het
Cdhr2 A T 13: 54,726,739 I875F probably damaging Het
Ceacam5 A T 7: 17,760,839 Y924F probably damaging Het
Clca4b A G 3: 144,922,860 I362T probably benign Het
Dchs2 A G 3: 83,346,155 probably null Het
Dlc1 T A 8: 36,937,964 T224S unknown Het
Dmxl2 T C 9: 54,366,632 probably null Het
Dnajc1 A G 2: 18,308,899 F137S probably damaging Het
E130311K13Rik T C 3: 63,929,301 T24A probably benign Het
Eya1 T C 1: 14,231,414 E317G probably null Het
Fpr-rs6 A G 17: 20,182,223 L292P probably damaging Het
Gca G T 2: 62,672,409 D54Y possibly damaging Het
Gm45861 G A 8: 27,534,489 probably null Het
Gm9573 T C 17: 35,620,676 S873G unknown Het
Gtf2a1l A G 17: 88,694,138 T141A possibly damaging Het
Hgsnat T C 8: 25,957,213 N351S probably benign Het
Htr1f A T 16: 64,926,020 V303E probably damaging Het
Iars2 C A 1: 185,322,866 W302L probably damaging Het
Igkv4-74 T A 6: 69,185,116 Q23L possibly damaging Het
Il18 A T 9: 50,565,373 probably benign Het
Ints4 A G 7: 97,506,128 D329G probably benign Het
Itsn1 T C 16: 91,853,185 F249S possibly damaging Het
Ktn1 A G 14: 47,694,632 E672G probably null Het
Lhx6 A G 2: 36,084,071 I359T possibly damaging Het
Lrp1b T C 2: 41,113,029 E2030G Het
Macf1 T A 4: 123,492,763 K1114N probably damaging Het
Mbd5 A G 2: 49,257,880 M701V possibly damaging Het
Mcemp1 A T 8: 3,667,065 M69L probably benign Het
Mfsd4b2 T A 10: 39,921,881 K159N probably benign Het
Mroh2b T A 15: 4,908,627 D243E probably damaging Het
Mug1 A T 6: 121,875,440 Q829L probably benign Het
Nav3 A T 10: 109,823,578 V726E probably damaging Het
Nfib T C 4: 82,353,589 Q247R probably benign Het
Npbwr1 T C 1: 5,916,932 N121S probably damaging Het
Olfr187 A T 16: 59,036,016 C240* probably null Het
Olfr378 T C 11: 73,425,470 D171G probably benign Het
Olfr691 T A 7: 105,337,500 D72V probably damaging Het
Pkd1l3 A G 8: 109,628,777 S726G probably benign Het
Ppip5k1 A T 2: 121,336,751 V847D probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Ripor2 G A 13: 24,696,307 V385M unknown Het
Rufy1 C T 11: 50,407,828 V379M possibly damaging Het
S100a5 A G 3: 90,609,900 K26R probably damaging Het
Sirt7 G A 11: 120,620,792 T225I probably benign Het
Slc17a2 A T 13: 23,822,418 T476S probably damaging Het
Slc38a6 T A 12: 73,350,577 M331K probably benign Het
Spam1 T C 6: 24,796,908 I286T probably damaging Het
Syne1 T A 10: 5,052,793 I214F possibly damaging Het
Tmtc1 A G 6: 148,325,145 L427P probably damaging Het
Tpbg G A 9: 85,844,850 A291T possibly damaging Het
Zfp40 A G 17: 23,178,388 F45S possibly damaging Het
Zfp451 C T 1: 33,777,013 V619M probably damaging Het
Zim1 A G 7: 6,677,812 L284P probably damaging Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Zmynd11 T A 13: 9,698,684 N154Y probably benign Het
Zscan12 A T 13: 21,369,287 H427L possibly damaging Het
Other mutations in Sin3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Sin3a APN 9 57097901 missense probably damaging 1.00
IGL00836:Sin3a APN 9 57107345 splice site probably null
IGL00913:Sin3a APN 9 57098118 missense probably benign 0.01
IGL01721:Sin3a APN 9 57095325 missense probably damaging 1.00
IGL01964:Sin3a APN 9 57107347 splice site probably benign
IGL02333:Sin3a APN 9 57107559 missense possibly damaging 0.86
IGL02673:Sin3a APN 9 57107441 missense probably damaging 0.99
Delicate UTSW 9 57103929 missense probably damaging 1.00
IGL03014:Sin3a UTSW 9 57095255 intron probably benign
PIT4519001:Sin3a UTSW 9 57095456 missense possibly damaging 0.86
R0024:Sin3a UTSW 9 57118253 intron probably benign
R0309:Sin3a UTSW 9 57110912 missense probably benign 0.00
R0511:Sin3a UTSW 9 57096895 nonsense probably null
R1205:Sin3a UTSW 9 57119175 missense probably damaging 1.00
R1365:Sin3a UTSW 9 57125203 nonsense probably null
R1496:Sin3a UTSW 9 57119158 missense possibly damaging 0.77
R1544:Sin3a UTSW 9 57103997 splice site probably benign
R1958:Sin3a UTSW 9 57105609 missense probably damaging 1.00
R1993:Sin3a UTSW 9 57101199 missense probably damaging 1.00
R2037:Sin3a UTSW 9 57096825 missense probably benign 0.14
R2065:Sin3a UTSW 9 57110800 missense possibly damaging 0.93
R2079:Sin3a UTSW 9 57089523 missense probably benign
R2193:Sin3a UTSW 9 57117477 missense possibly damaging 0.93
R3004:Sin3a UTSW 9 57096834 nonsense probably null
R3929:Sin3a UTSW 9 57118137 missense probably damaging 0.98
R4326:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4327:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4329:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4765:Sin3a UTSW 9 57096803 missense probably benign 0.14
R4806:Sin3a UTSW 9 57086742 missense probably damaging 0.99
R4979:Sin3a UTSW 9 57118076 missense probably damaging 1.00
R5018:Sin3a UTSW 9 57110891 missense probably benign 0.00
R5368:Sin3a UTSW 9 57110800 missense possibly damaging 0.93
R5379:Sin3a UTSW 9 57110988 missense probably benign 0.10
R5391:Sin3a UTSW 9 57105673 missense probably damaging 1.00
R5395:Sin3a UTSW 9 57105673 missense probably damaging 1.00
R5519:Sin3a UTSW 9 57118173 critical splice donor site probably null
R5927:Sin3a UTSW 9 57111111 missense probably damaging 1.00
R5987:Sin3a UTSW 9 57127200 missense possibly damaging 0.75
R6083:Sin3a UTSW 9 57107540 missense probably damaging 1.00
R6161:Sin3a UTSW 9 57095424 missense possibly damaging 0.48
R6196:Sin3a UTSW 9 57103929 missense probably damaging 1.00
R6374:Sin3a UTSW 9 57117481 missense probably benign
R6456:Sin3a UTSW 9 57113701 missense possibly damaging 0.79
R6815:Sin3a UTSW 9 57117540 missense probably benign 0.02
R6900:Sin3a UTSW 9 57107574 missense probably damaging 1.00
R7051:Sin3a UTSW 9 57103934 missense probably damaging 1.00
R7081:Sin3a UTSW 9 57094471 missense probably null 1.00
R7285:Sin3a UTSW 9 57127299 missense possibly damaging 0.57
R7538:Sin3a UTSW 9 57103926 missense possibly damaging 0.95
RF017:Sin3a UTSW 9 57127326 missense possibly damaging 0.90
X0026:Sin3a UTSW 9 57125192 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCCTGATCTGATCATGGGC -3'
(R):5'- ACAAACAAGAGTCCTCGAGTTC -3'

Sequencing Primer
(F):5'- GATCTGATCATGGGCTTTAACACC -3'
(R):5'- AAGAGTCCTCGAGTTCGCTGG -3'
Posted On2019-10-07