Incidental Mutation 'R7462:Tpbg'
ID578512
Institutional Source Beutler Lab
Gene Symbol Tpbg
Ensembl Gene ENSMUSG00000035274
Gene Nametrophoblast glycoprotein
Synonyms5T4 oncofetal antigen, 5T4
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.486) question?
Stock #R7462 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location85842380-85847040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85844850 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 291 (A291T)
Ref Sequence ENSEMBL: ENSMUSP00000006559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006559] [ENSMUST00000098500]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006559
AA Change: A291T

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000006559
Gene: ENSMUSG00000035274
AA Change: A291T

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LRRNT 61 95 1.27e-6 SMART
LRR 94 113 1.53e2 SMART
LRR_TYP 117 140 1.92e-2 SMART
LRR_TYP 141 164 6.88e-4 SMART
LRR 215 238 6.22e0 SMART
LRR_TYP 239 262 2.2e-2 SMART
LRR 263 286 2.67e-1 SMART
LRRCT 300 351 9.1e-14 SMART
transmembrane domain 360 382 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098500
AA Change: A291T

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096101
Gene: ENSMUSG00000035274
AA Change: A291T

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LRRNT 61 95 1.27e-6 SMART
LRR 94 113 1.53e2 SMART
LRR_TYP 117 140 1.92e-2 SMART
LRR_TYP 141 164 6.88e-4 SMART
LRR 215 238 6.22e0 SMART
LRR_TYP 239 262 2.2e-2 SMART
LRR 263 286 2.67e-1 SMART
LRRCT 300 351 9.1e-14 SMART
transmembrane domain 360 382 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich transmembrane glycoprotein that may be involved in cell adhesion. The encoded protein is an oncofetal antigen that is specific to trophoblast cells. In adults this protein is highly expressed in many tumor cells and is associated with poor clinical outcome in numerous cancers. Alternate splicing in the 5' UTR results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit low penetrance hydrocephaly and premature death. Embryonic stem cells isolated from these mice exhibit impaired mesenchyme differentiation and reduced chemotaxis following differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 G C 3: 126,943,034 T3067S unknown Het
Ankrd28 T C 14: 31,778,929 N35S probably benign Het
Bicra A T 7: 15,979,135 S996T possibly damaging Het
Btbd7 T C 12: 102,837,722 E353G possibly damaging Het
Ccdc144b T A 3: 36,025,906 probably null Het
Cdhr2 A T 13: 54,726,739 I875F probably damaging Het
Ceacam5 A T 7: 17,760,839 Y924F probably damaging Het
Clca4b A G 3: 144,922,860 I362T probably benign Het
Dchs2 A G 3: 83,346,155 probably null Het
Dlc1 T A 8: 36,937,964 T224S unknown Het
Dmxl2 T C 9: 54,366,632 probably null Het
Dnajc1 A G 2: 18,308,899 F137S probably damaging Het
E130311K13Rik T C 3: 63,929,301 T24A probably benign Het
Eya1 T C 1: 14,231,414 E317G probably null Het
Fpr-rs6 A G 17: 20,182,223 L292P probably damaging Het
Gca G T 2: 62,672,409 D54Y possibly damaging Het
Gm45861 G A 8: 27,534,489 probably null Het
Gm9573 T C 17: 35,620,676 S873G unknown Het
Gtf2a1l A G 17: 88,694,138 T141A possibly damaging Het
Hgsnat T C 8: 25,957,213 N351S probably benign Het
Htr1f A T 16: 64,926,020 V303E probably damaging Het
Iars2 C A 1: 185,322,866 W302L probably damaging Het
Igkv4-74 T A 6: 69,185,116 Q23L possibly damaging Het
Il18 A T 9: 50,565,373 probably benign Het
Ints4 A G 7: 97,506,128 D329G probably benign Het
Itsn1 T C 16: 91,853,185 F249S possibly damaging Het
Ktn1 A G 14: 47,694,632 E672G probably null Het
Lhx6 A G 2: 36,084,071 I359T possibly damaging Het
Lrp1b T C 2: 41,113,029 E2030G Het
Macf1 T A 4: 123,492,763 K1114N probably damaging Het
Mbd5 A G 2: 49,257,880 M701V possibly damaging Het
Mcemp1 A T 8: 3,667,065 M69L probably benign Het
Mfsd4b2 T A 10: 39,921,881 K159N probably benign Het
Mroh2b T A 15: 4,908,627 D243E probably damaging Het
Mug1 A T 6: 121,875,440 Q829L probably benign Het
Nav3 A T 10: 109,823,578 V726E probably damaging Het
Nfib T C 4: 82,353,589 Q247R probably benign Het
Npbwr1 T C 1: 5,916,932 N121S probably damaging Het
Olfr187 A T 16: 59,036,016 C240* probably null Het
Olfr378 T C 11: 73,425,470 D171G probably benign Het
Olfr691 T A 7: 105,337,500 D72V probably damaging Het
Pkd1l3 A G 8: 109,628,777 S726G probably benign Het
Ppip5k1 A T 2: 121,336,751 V847D probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Ripor2 G A 13: 24,696,307 V385M unknown Het
Rufy1 C T 11: 50,407,828 V379M possibly damaging Het
S100a5 A G 3: 90,609,900 K26R probably damaging Het
Sin3a T C 9: 57,095,525 S234P probably benign Het
Sirt7 G A 11: 120,620,792 T225I probably benign Het
Slc17a2 A T 13: 23,822,418 T476S probably damaging Het
Slc38a6 T A 12: 73,350,577 M331K probably benign Het
Spam1 T C 6: 24,796,908 I286T probably damaging Het
Syne1 T A 10: 5,052,793 I214F possibly damaging Het
Tmtc1 A G 6: 148,325,145 L427P probably damaging Het
Zfp40 A G 17: 23,178,388 F45S possibly damaging Het
Zfp451 C T 1: 33,777,013 V619M probably damaging Het
Zim1 A G 7: 6,677,812 L284P probably damaging Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Zmynd11 T A 13: 9,698,684 N154Y probably benign Het
Zscan12 A T 13: 21,369,287 H427L possibly damaging Het
Other mutations in Tpbg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Tpbg APN 9 85844092 missense unknown
IGL01789:Tpbg APN 9 85844901 missense probably benign 0.00
IGL01987:Tpbg APN 9 85845199 missense probably damaging 1.00
R0399:Tpbg UTSW 9 85844938 missense possibly damaging 0.63
R0418:Tpbg UTSW 9 85844750 nonsense probably null
R0904:Tpbg UTSW 9 85844564 missense unknown
R1748:Tpbg UTSW 9 85844376 missense probably damaging 1.00
R3744:Tpbg UTSW 9 85845162 missense probably damaging 1.00
R3836:Tpbg UTSW 9 85843114 intron probably benign
R3837:Tpbg UTSW 9 85843114 intron probably benign
R3839:Tpbg UTSW 9 85843114 intron probably benign
R5221:Tpbg UTSW 9 85844425 missense probably damaging 1.00
R6488:Tpbg UTSW 9 85844485 missense possibly damaging 0.70
R7192:Tpbg UTSW 9 85844032 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCCTGCCTCGGGACTTACTAG -3'
(R):5'- CATAGGAAGTCTGCAGGGATTG -3'

Sequencing Primer
(F):5'- TCGGGACTTACTAGCCCAACTG -3'
(R):5'- TCACAGTCCAGGTCAGAGCTG -3'
Posted On2019-10-07