Incidental Mutation 'R7462:Mfsd4b2'
ID578514
Institutional Source Beutler Lab
Gene Symbol Mfsd4b2
Ensembl Gene ENSMUSG00000039339
Gene Namemajor facilitator superfamily domain containing 4B2
Synonyms2010001E11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R7462 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location39920382-39926923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39921881 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 159 (K159N)
Ref Sequence ENSEMBL: ENSMUSP00000040384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045526]
Predicted Effect probably benign
Transcript: ENSMUST00000045526
AA Change: K159N

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000040384
Gene: ENSMUSG00000039339
AA Change: K159N

DomainStartEndE-ValueType
Pfam:MFS_1 1 322 3.9e-11 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 G C 3: 126,943,034 T3067S unknown Het
Ankrd28 T C 14: 31,778,929 N35S probably benign Het
Bicra A T 7: 15,979,135 S996T possibly damaging Het
Btbd7 T C 12: 102,837,722 E353G possibly damaging Het
Ccdc144b T A 3: 36,025,906 probably null Het
Cdhr2 A T 13: 54,726,739 I875F probably damaging Het
Ceacam5 A T 7: 17,760,839 Y924F probably damaging Het
Clca4b A G 3: 144,922,860 I362T probably benign Het
Dchs2 A G 3: 83,346,155 probably null Het
Dlc1 T A 8: 36,937,964 T224S unknown Het
Dmxl2 T C 9: 54,366,632 probably null Het
Dnajc1 A G 2: 18,308,899 F137S probably damaging Het
E130311K13Rik T C 3: 63,929,301 T24A probably benign Het
Eya1 T C 1: 14,231,414 E317G probably null Het
Fpr-rs6 A G 17: 20,182,223 L292P probably damaging Het
Gca G T 2: 62,672,409 D54Y possibly damaging Het
Gm45861 G A 8: 27,534,489 probably null Het
Gm9573 T C 17: 35,620,676 S873G unknown Het
Gtf2a1l A G 17: 88,694,138 T141A possibly damaging Het
Hgsnat T C 8: 25,957,213 N351S probably benign Het
Htr1f A T 16: 64,926,020 V303E probably damaging Het
Iars2 C A 1: 185,322,866 W302L probably damaging Het
Igkv4-74 T A 6: 69,185,116 Q23L possibly damaging Het
Il18 A T 9: 50,565,373 probably benign Het
Ints4 A G 7: 97,506,128 D329G probably benign Het
Itsn1 T C 16: 91,853,185 F249S possibly damaging Het
Ktn1 A G 14: 47,694,632 E672G probably null Het
Lhx6 A G 2: 36,084,071 I359T possibly damaging Het
Lrp1b T C 2: 41,113,029 E2030G Het
Macf1 T A 4: 123,492,763 K1114N probably damaging Het
Mbd5 A G 2: 49,257,880 M701V possibly damaging Het
Mcemp1 A T 8: 3,667,065 M69L probably benign Het
Mroh2b T A 15: 4,908,627 D243E probably damaging Het
Mug1 A T 6: 121,875,440 Q829L probably benign Het
Nav3 A T 10: 109,823,578 V726E probably damaging Het
Nfib T C 4: 82,353,589 Q247R probably benign Het
Npbwr1 T C 1: 5,916,932 N121S probably damaging Het
Olfr187 A T 16: 59,036,016 C240* probably null Het
Olfr378 T C 11: 73,425,470 D171G probably benign Het
Olfr691 T A 7: 105,337,500 D72V probably damaging Het
Pkd1l3 A G 8: 109,628,777 S726G probably benign Het
Ppip5k1 A T 2: 121,336,751 V847D probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Ripor2 G A 13: 24,696,307 V385M unknown Het
Rufy1 C T 11: 50,407,828 V379M possibly damaging Het
S100a5 A G 3: 90,609,900 K26R probably damaging Het
Sin3a T C 9: 57,095,525 S234P probably benign Het
Sirt7 G A 11: 120,620,792 T225I probably benign Het
Slc17a2 A T 13: 23,822,418 T476S probably damaging Het
Slc38a6 T A 12: 73,350,577 M331K probably benign Het
Spam1 T C 6: 24,796,908 I286T probably damaging Het
Syne1 T A 10: 5,052,793 I214F possibly damaging Het
Tmtc1 A G 6: 148,325,145 L427P probably damaging Het
Tpbg G A 9: 85,844,850 A291T possibly damaging Het
Zfp40 A G 17: 23,178,388 F45S possibly damaging Het
Zfp451 C T 1: 33,777,013 V619M probably damaging Het
Zim1 A G 7: 6,677,812 L284P probably damaging Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Zmynd11 T A 13: 9,698,684 N154Y probably benign Het
Zscan12 A T 13: 21,369,287 H427L possibly damaging Het
Other mutations in Mfsd4b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Mfsd4b2 APN 10 39925061 splice site probably benign
IGL01546:Mfsd4b2 APN 10 39921475 missense probably damaging 1.00
IGL01662:Mfsd4b2 APN 10 39922197 splice site probably benign
IGL02151:Mfsd4b2 APN 10 39921691 missense probably damaging 1.00
R1928:Mfsd4b2 UTSW 10 39921462 missense probably damaging 1.00
R2851:Mfsd4b2 UTSW 10 39922123 missense probably benign 0.07
R3777:Mfsd4b2 UTSW 10 39921531 missense possibly damaging 0.54
R5055:Mfsd4b2 UTSW 10 39923777 missense possibly damaging 0.79
R5257:Mfsd4b2 UTSW 10 39922021 missense probably benign 0.00
R5258:Mfsd4b2 UTSW 10 39922021 missense probably benign 0.00
R5563:Mfsd4b2 UTSW 10 39922042 missense probably benign 0.15
R5728:Mfsd4b2 UTSW 10 39923795 missense possibly damaging 0.47
R5888:Mfsd4b2 UTSW 10 39922035 missense probably benign 0.00
R6147:Mfsd4b2 UTSW 10 39921577 missense probably benign
R6362:Mfsd4b2 UTSW 10 39921609 missense probably damaging 1.00
R7801:Mfsd4b2 UTSW 10 39923781 missense probably benign 0.00
Z1176:Mfsd4b2 UTSW 10 39921600 missense not run
Predicted Primers PCR Primer
(F):5'- AAGATGGAGTTCAAGCCAGC -3'
(R):5'- GCACTTCAGTTTTGCCTTGG -3'

Sequencing Primer
(F):5'- AGTTCAAGCCAGCTGCCTC -3'
(R):5'- TGGGGCACAACAGCATCTG -3'
Posted On2019-10-07