Incidental Mutation 'R7462:Sirt7'
ID578518
Institutional Source Beutler Lab
Gene Symbol Sirt7
Ensembl Gene ENSMUSG00000025138
Gene Namesirtuin 7
Synonyms
Accession Numbers

Genbank: NM_153056.2; Ensembl: ENSMUST00000080202

Is this an essential gene? Possibly essential (E-score: 0.673) question?
Stock #R7462 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location120618372-120625240 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120620792 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 225 (T225I)
Ref Sequence ENSEMBL: ENSMUSP00000079093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026129] [ENSMUST00000058162] [ENSMUST00000080202] [ENSMUST00000106183] [ENSMUST00000106188] [ENSMUST00000146809]
Predicted Effect probably benign
Transcript: ENSMUST00000026129
SMART Domains Protein: ENSMUSP00000026129
Gene: ENSMUSG00000025137

DomainStartEndE-ValueType
Pfam:CTP_transf_like 26 152 2.6e-32 PFAM
Pfam:CTP_transf_like 235 384 8.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058162
SMART Domains Protein: ENSMUSP00000053899
Gene: ENSMUSG00000051510

DomainStartEndE-ValueType
BRLZ 46 113 4.43e-7 SMART
low complexity region 125 143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080202
AA Change: T225I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000079093
Gene: ENSMUSG00000025138
AA Change: T225I

DomainStartEndE-ValueType
coiled coil region 24 48 N/A INTRINSIC
low complexity region 65 78 N/A INTRINSIC
Pfam:SIR2 134 276 1.1e-22 PFAM
low complexity region 393 400 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106183
SMART Domains Protein: ENSMUSP00000101789
Gene: ENSMUSG00000025138

DomainStartEndE-ValueType
coiled coil region 24 48 N/A INTRINSIC
low complexity region 65 78 N/A INTRINSIC
SCOP:d1icia_ 92 113 7e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106188
SMART Domains Protein: ENSMUSP00000101794
Gene: ENSMUSG00000025137

DomainStartEndE-ValueType
Pfam:CTP_transf_2 26 152 9.8e-25 PFAM
Pfam:CTP_transf_2 217 332 2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146809
AA Change: T38I

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120405
Gene: ENSMUSG00000025138
AA Change: T38I

DomainStartEndE-ValueType
Pfam:SIR2 1 89 1.6e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class IV of the sirtuin family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit premature aging and death associated with inflammatory, degenerative cardiac hypertrophy and cardiac fibrosis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Targeted, other(1)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 G C 3: 126,943,034 T3067S unknown Het
Ankrd28 T C 14: 31,778,929 N35S probably benign Het
Bicra A T 7: 15,979,135 S996T possibly damaging Het
Btbd7 T C 12: 102,837,722 E353G possibly damaging Het
Ccdc144b T A 3: 36,025,906 probably null Het
Cdhr2 A T 13: 54,726,739 I875F probably damaging Het
Ceacam5 A T 7: 17,760,839 Y924F probably damaging Het
Clca4b A G 3: 144,922,860 I362T probably benign Het
Dchs2 A G 3: 83,346,155 probably null Het
Dlc1 T A 8: 36,937,964 T224S unknown Het
Dmxl2 T C 9: 54,366,632 probably null Het
Dnajc1 A G 2: 18,308,899 F137S probably damaging Het
E130311K13Rik T C 3: 63,929,301 T24A probably benign Het
Eya1 T C 1: 14,231,414 E317G probably null Het
Fpr-rs6 A G 17: 20,182,223 L292P probably damaging Het
Gca G T 2: 62,672,409 D54Y possibly damaging Het
Gm45861 G A 8: 27,534,489 probably null Het
Gm9573 T C 17: 35,620,676 S873G unknown Het
Gtf2a1l A G 17: 88,694,138 T141A possibly damaging Het
Hgsnat T C 8: 25,957,213 N351S probably benign Het
Htr1f A T 16: 64,926,020 V303E probably damaging Het
Iars2 C A 1: 185,322,866 W302L probably damaging Het
Igkv4-74 T A 6: 69,185,116 Q23L possibly damaging Het
Il18 A T 9: 50,565,373 probably benign Het
Ints4 A G 7: 97,506,128 D329G probably benign Het
Itsn1 T C 16: 91,853,185 F249S possibly damaging Het
Ktn1 A G 14: 47,694,632 E672G probably null Het
Lhx6 A G 2: 36,084,071 I359T possibly damaging Het
Lrp1b T C 2: 41,113,029 E2030G Het
Macf1 T A 4: 123,492,763 K1114N probably damaging Het
Mbd5 A G 2: 49,257,880 M701V possibly damaging Het
Mcemp1 A T 8: 3,667,065 M69L probably benign Het
Mfsd4b2 T A 10: 39,921,881 K159N probably benign Het
Mroh2b T A 15: 4,908,627 D243E probably damaging Het
Mug1 A T 6: 121,875,440 Q829L probably benign Het
Nav3 A T 10: 109,823,578 V726E probably damaging Het
Nfib T C 4: 82,353,589 Q247R probably benign Het
Npbwr1 T C 1: 5,916,932 N121S probably damaging Het
Olfr187 A T 16: 59,036,016 C240* probably null Het
Olfr378 T C 11: 73,425,470 D171G probably benign Het
Olfr691 T A 7: 105,337,500 D72V probably damaging Het
Pkd1l3 A G 8: 109,628,777 S726G probably benign Het
Ppip5k1 A T 2: 121,336,751 V847D probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Ripor2 G A 13: 24,696,307 V385M unknown Het
Rufy1 C T 11: 50,407,828 V379M possibly damaging Het
S100a5 A G 3: 90,609,900 K26R probably damaging Het
Sin3a T C 9: 57,095,525 S234P probably benign Het
Slc17a2 A T 13: 23,822,418 T476S probably damaging Het
Slc38a6 T A 12: 73,350,577 M331K probably benign Het
Spam1 T C 6: 24,796,908 I286T probably damaging Het
Syne1 T A 10: 5,052,793 I214F possibly damaging Het
Tmtc1 A G 6: 148,325,145 L427P probably damaging Het
Tpbg G A 9: 85,844,850 A291T possibly damaging Het
Zfp40 A G 17: 23,178,388 F45S possibly damaging Het
Zfp451 C T 1: 33,777,013 V619M probably damaging Het
Zim1 A G 7: 6,677,812 L284P probably damaging Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Zmynd11 T A 13: 9,698,684 N154Y probably benign Het
Zscan12 A T 13: 21,369,287 H427L possibly damaging Het
Other mutations in Sirt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Sirt7 APN 11 120618909 missense probably benign 0.04
IGL02253:Sirt7 APN 11 120620867 missense probably benign 0.00
IGL02928:Sirt7 APN 11 120620216 missense probably benign 0.03
1mM(1):Sirt7 UTSW 11 120622144 missense probably benign 0.00
R0634:Sirt7 UTSW 11 120622129 unclassified probably benign
R1677:Sirt7 UTSW 11 120624539 missense possibly damaging 0.92
R2279:Sirt7 UTSW 11 120624495 missense probably damaging 1.00
R5260:Sirt7 UTSW 11 120620521 intron probably benign
R5712:Sirt7 UTSW 11 120620851 nonsense probably null
R7186:Sirt7 UTSW 11 120620485 missense probably benign
R7194:Sirt7 UTSW 11 120618973 missense probably benign 0.00
R7491:Sirt7 UTSW 11 120619011 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCATGGTATGGTCGGCAC -3'
(R):5'- TCTCAGAACTGTGATGGGCTC -3'

Sequencing Primer
(F):5'- GTATGGTCGGCACATACCTTCAAG -3'
(R):5'- CATCTCAGAGCTCCATGGGAATATG -3'
Posted On2019-10-07