Incidental Mutation 'R7462:Zscan12'
ID578522
Institutional Source Beutler Lab
Gene Symbol Zscan12
Ensembl Gene ENSMUSG00000036721
Gene Namezinc finger and SCAN domain containing 12
SynonymsZfp96
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7462 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location21362820-21372289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21369287 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 427 (H427L)
Ref Sequence ENSEMBL: ENSMUSP00000058904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053293] [ENSMUST00000099720] [ENSMUST00000225545]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053293
AA Change: H427L

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000058904
Gene: ENSMUSG00000036721
AA Change: H427L

DomainStartEndE-ValueType
SCAN 42 154 2.52e-74 SMART
ZnF_C2H2 269 291 5.5e-3 SMART
ZnF_C2H2 297 319 1.72e-4 SMART
ZnF_C2H2 325 347 1.22e-4 SMART
ZnF_C2H2 353 375 5.5e-3 SMART
ZnF_C2H2 381 403 1.95e-3 SMART
ZnF_C2H2 409 431 1.45e-2 SMART
ZnF_C2H2 455 477 2.43e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000099720
AA Change: H427L

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097308
Gene: ENSMUSG00000036721
AA Change: H427L

DomainStartEndE-ValueType
SCAN 42 154 2.52e-74 SMART
ZnF_C2H2 269 291 5.5e-3 SMART
ZnF_C2H2 297 319 1.72e-4 SMART
ZnF_C2H2 325 347 1.22e-4 SMART
ZnF_C2H2 353 375 5.5e-3 SMART
ZnF_C2H2 381 403 1.95e-3 SMART
ZnF_C2H2 409 431 1.45e-2 SMART
ZnF_C2H2 455 477 2.43e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000225545
AA Change: H427L

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 G C 3: 126,943,034 T3067S unknown Het
Ankrd28 T C 14: 31,778,929 N35S probably benign Het
Bicra A T 7: 15,979,135 S996T possibly damaging Het
Btbd7 T C 12: 102,837,722 E353G possibly damaging Het
Ccdc144b T A 3: 36,025,906 probably null Het
Cdhr2 A T 13: 54,726,739 I875F probably damaging Het
Ceacam5 A T 7: 17,760,839 Y924F probably damaging Het
Clca4b A G 3: 144,922,860 I362T probably benign Het
Dchs2 A G 3: 83,346,155 probably null Het
Dlc1 T A 8: 36,937,964 T224S unknown Het
Dmxl2 T C 9: 54,366,632 probably null Het
Dnajc1 A G 2: 18,308,899 F137S probably damaging Het
E130311K13Rik T C 3: 63,929,301 T24A probably benign Het
Eya1 T C 1: 14,231,414 E317G probably null Het
Fpr-rs6 A G 17: 20,182,223 L292P probably damaging Het
Gca G T 2: 62,672,409 D54Y possibly damaging Het
Gm45861 G A 8: 27,534,489 probably null Het
Gm9573 T C 17: 35,620,676 S873G unknown Het
Gtf2a1l A G 17: 88,694,138 T141A possibly damaging Het
Hgsnat T C 8: 25,957,213 N351S probably benign Het
Htr1f A T 16: 64,926,020 V303E probably damaging Het
Iars2 C A 1: 185,322,866 W302L probably damaging Het
Igkv4-74 T A 6: 69,185,116 Q23L possibly damaging Het
Il18 A T 9: 50,565,373 probably benign Het
Ints4 A G 7: 97,506,128 D329G probably benign Het
Itsn1 T C 16: 91,853,185 F249S possibly damaging Het
Ktn1 A G 14: 47,694,632 E672G probably null Het
Lhx6 A G 2: 36,084,071 I359T possibly damaging Het
Lrp1b T C 2: 41,113,029 E2030G Het
Macf1 T A 4: 123,492,763 K1114N probably damaging Het
Mbd5 A G 2: 49,257,880 M701V possibly damaging Het
Mcemp1 A T 8: 3,667,065 M69L probably benign Het
Mfsd4b2 T A 10: 39,921,881 K159N probably benign Het
Mroh2b T A 15: 4,908,627 D243E probably damaging Het
Mug1 A T 6: 121,875,440 Q829L probably benign Het
Nav3 A T 10: 109,823,578 V726E probably damaging Het
Nfib T C 4: 82,353,589 Q247R probably benign Het
Npbwr1 T C 1: 5,916,932 N121S probably damaging Het
Olfr187 A T 16: 59,036,016 C240* probably null Het
Olfr378 T C 11: 73,425,470 D171G probably benign Het
Olfr691 T A 7: 105,337,500 D72V probably damaging Het
Pkd1l3 A G 8: 109,628,777 S726G probably benign Het
Ppip5k1 A T 2: 121,336,751 V847D probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Ripor2 G A 13: 24,696,307 V385M unknown Het
Rufy1 C T 11: 50,407,828 V379M possibly damaging Het
S100a5 A G 3: 90,609,900 K26R probably damaging Het
Sin3a T C 9: 57,095,525 S234P probably benign Het
Sirt7 G A 11: 120,620,792 T225I probably benign Het
Slc17a2 A T 13: 23,822,418 T476S probably damaging Het
Slc38a6 T A 12: 73,350,577 M331K probably benign Het
Spam1 T C 6: 24,796,908 I286T probably damaging Het
Syne1 T A 10: 5,052,793 I214F possibly damaging Het
Tmtc1 A G 6: 148,325,145 L427P probably damaging Het
Tpbg G A 9: 85,844,850 A291T possibly damaging Het
Zfp40 A G 17: 23,178,388 F45S possibly damaging Het
Zfp451 C T 1: 33,777,013 V619M probably damaging Het
Zim1 A G 7: 6,677,812 L284P probably damaging Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Zmynd11 T A 13: 9,698,684 N154Y probably benign Het
Other mutations in Zscan12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02864:Zscan12 APN 13 21368560 missense probably benign 0.02
PIT4480001:Zscan12 UTSW 13 21368574 missense possibly damaging 0.72
R0122:Zscan12 UTSW 13 21368969 missense probably damaging 1.00
R1605:Zscan12 UTSW 13 21366643 missense probably benign 0.00
R1639:Zscan12 UTSW 13 21368986 missense probably damaging 0.99
R2182:Zscan12 UTSW 13 21368791 missense probably benign 0.33
R2931:Zscan12 UTSW 13 21364017 missense possibly damaging 0.92
R3930:Zscan12 UTSW 13 21368630 missense probably benign 0.18
R4368:Zscan12 UTSW 13 21369383 missense probably benign 0.00
R4461:Zscan12 UTSW 13 21366619 missense possibly damaging 0.83
R4545:Zscan12 UTSW 13 21366705 missense possibly damaging 0.83
R5353:Zscan12 UTSW 13 21364008 missense possibly damaging 0.51
R6580:Zscan12 UTSW 13 21369158 missense probably damaging 0.99
R6734:Zscan12 UTSW 13 21368796 nonsense probably null
R7505:Zscan12 UTSW 13 21368586 missense possibly damaging 0.72
R7822:Zscan12 UTSW 13 21369204 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTTTTACTCAGCACTCGCG -3'
(R):5'- CTCTGACTCCTGTCTGAAGGTC -3'

Sequencing Primer
(F):5'- TATTCGACACAAGGTGGTCC -3'
(R):5'- GCCACATTCATCACACTTGTAGGG -3'
Posted On2019-10-07