Incidental Mutation 'R7462:Slc34a1'
ID 578524
Institutional Source Beutler Lab
Gene Symbol Slc34a1
Ensembl Gene ENSMUSG00000021490
Gene Name solute carrier family 34 (sodium phosphate), member 1
Synonyms Slc17a2, Npt2, Na/Pi cotransporter, renal Na+/Pi transporter, NaPi-IIa
MMRRC Submission 045536-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R7462 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 55547435-55562508 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24006401 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 476 (T476S)
Ref Sequence ENSEMBL: ENSMUSP00000097288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006786] [ENSMUST00000099697]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006786
SMART Domains Protein: ENSMUSP00000006786
Gene: ENSMUSG00000036110

DomainStartEndE-ValueType
Pfam:MFS_1 19 425 3.5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099697
AA Change: T476S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097288
Gene: ENSMUSG00000036110
AA Change: T476S

DomainStartEndE-ValueType
Pfam:MFS_1 19 425 2.9e-45 PFAM
transmembrane domain 443 462 N/A INTRINSIC
Meta Mutation Damage Score 0.0997 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II sodium-phosphate cotransporter family. Mutations in this gene are associated with hypophosphatemia nephrolithiasis/osteoporosis 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice exhibit renal phosphate wasting, hyerpcalciuria, and skeletal abnormalities. Postnatal viability is reduced, putatively due to poor nutritional status. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 G C 3: 126,736,683 (GRCm39) T3067S unknown Het
Ankrd28 T C 14: 31,500,886 (GRCm39) N35S probably benign Het
Bicra A T 7: 15,713,060 (GRCm39) S996T possibly damaging Het
Btbd7 T C 12: 102,803,981 (GRCm39) E353G possibly damaging Het
Cdhr2 A T 13: 54,874,552 (GRCm39) I875F probably damaging Het
Ceacam5 A T 7: 17,494,764 (GRCm39) Y924F probably damaging Het
Clca4b A G 3: 144,628,621 (GRCm39) I362T probably benign Het
Dchs2 A G 3: 83,253,462 (GRCm39) probably null Het
Dlc1 T A 8: 37,405,118 (GRCm39) T224S unknown Het
Dmxl2 T C 9: 54,273,916 (GRCm39) probably null Het
Dnajc1 A G 2: 18,313,710 (GRCm39) F137S probably damaging Het
E130311K13Rik T C 3: 63,836,722 (GRCm39) T24A probably benign Het
Eya1 T C 1: 14,301,638 (GRCm39) E317G probably null Het
Fpr-rs6 A G 17: 20,402,485 (GRCm39) L292P probably damaging Het
Gca G T 2: 62,502,753 (GRCm39) D54Y possibly damaging Het
Gm45861 G A 8: 28,024,517 (GRCm39) probably null Het
Gm57858 T A 3: 36,080,055 (GRCm39) probably null Het
Gtf2a1l A G 17: 89,001,566 (GRCm39) T141A possibly damaging Het
Hgsnat T C 8: 26,447,241 (GRCm39) N351S probably benign Het
Htr1f A T 16: 64,746,383 (GRCm39) V303E probably damaging Het
Iars2 C A 1: 185,055,063 (GRCm39) W302L probably damaging Het
Igkv4-74 T A 6: 69,162,100 (GRCm39) Q23L possibly damaging Het
Il18 A T 9: 50,476,673 (GRCm39) probably benign Het
Ints4 A G 7: 97,155,335 (GRCm39) D329G probably benign Het
Itsn1 T C 16: 91,650,073 (GRCm39) F249S possibly damaging Het
Ktn1 A G 14: 47,932,089 (GRCm39) E672G probably null Het
Lhx6 A G 2: 35,974,083 (GRCm39) I359T possibly damaging Het
Lrp1b T C 2: 41,003,041 (GRCm39) E2030G Het
Macf1 T A 4: 123,386,556 (GRCm39) K1114N probably damaging Het
Mbd5 A G 2: 49,147,892 (GRCm39) M701V possibly damaging Het
Mcemp1 A T 8: 3,717,065 (GRCm39) M69L probably benign Het
Mfsd4b2 T A 10: 39,797,877 (GRCm39) K159N probably benign Het
Mroh2b T A 15: 4,938,109 (GRCm39) D243E probably damaging Het
Muc21 T C 17: 35,931,568 (GRCm39) S873G unknown Het
Mug1 A T 6: 121,852,399 (GRCm39) Q829L probably benign Het
Nav3 A T 10: 109,659,439 (GRCm39) V726E probably damaging Het
Nfib T C 4: 82,271,826 (GRCm39) Q247R probably benign Het
Npbwr1 T C 1: 5,987,151 (GRCm39) N121S probably damaging Het
Or1e19 T C 11: 73,316,296 (GRCm39) D171G probably benign Het
Or52b2 T A 7: 104,986,707 (GRCm39) D72V probably damaging Het
Or5h19 A T 16: 58,856,379 (GRCm39) C240* probably null Het
Pkd1l3 A G 8: 110,355,409 (GRCm39) S726G probably benign Het
Ppip5k1 A T 2: 121,167,232 (GRCm39) V847D probably damaging Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Ripor2 G A 13: 24,880,290 (GRCm39) V385M unknown Het
Rufy1 C T 11: 50,298,655 (GRCm39) V379M possibly damaging Het
S100a5 A G 3: 90,517,207 (GRCm39) K26R probably damaging Het
Sin3a T C 9: 57,002,809 (GRCm39) S234P probably benign Het
Sirt7 G A 11: 120,511,618 (GRCm39) T225I probably benign Het
Slc38a6 T A 12: 73,397,351 (GRCm39) M331K probably benign Het
Spam1 T C 6: 24,796,907 (GRCm39) I286T probably damaging Het
Syne1 T A 10: 5,002,793 (GRCm39) I214F possibly damaging Het
Tmtc1 A G 6: 148,226,643 (GRCm39) L427P probably damaging Het
Tpbg G A 9: 85,726,903 (GRCm39) A291T possibly damaging Het
Zfp40 A G 17: 23,397,362 (GRCm39) F45S possibly damaging Het
Zfp451 C T 1: 33,816,094 (GRCm39) V619M probably damaging Het
Zim1 A G 7: 6,680,811 (GRCm39) L284P probably damaging Het
Zkscan4 A G 13: 21,668,044 (GRCm39) E165G probably benign Het
Zmynd11 T A 13: 9,748,720 (GRCm39) N154Y probably benign Het
Zscan12 A T 13: 21,553,457 (GRCm39) H427L possibly damaging Het
Other mutations in Slc34a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Slc34a1 APN 13 24,003,317 (GRCm39) missense probably benign 0.13
IGL01120:Slc34a1 APN 13 55,556,884 (GRCm39) missense probably damaging 1.00
IGL01396:Slc34a1 APN 13 55,550,546 (GRCm39) missense probably damaging 1.00
IGL01405:Slc34a1 APN 13 55,559,941 (GRCm39) missense probably damaging 1.00
IGL01511:Slc34a1 APN 13 24,003,121 (GRCm39) critical splice donor site probably null
IGL01624:Slc34a1 APN 13 23,998,969 (GRCm39) missense probably benign 0.00
IGL01839:Slc34a1 APN 13 23,996,668 (GRCm39) missense possibly damaging 0.91
IGL02010:Slc34a1 APN 13 24,003,025 (GRCm39) missense probably benign 0.00
IGL02525:Slc34a1 APN 13 55,551,051 (GRCm39) splice site probably benign
IGL02555:Slc34a1 APN 13 55,548,981 (GRCm39) missense possibly damaging 0.77
IGL02692:Slc34a1 APN 13 55,551,049 (GRCm39) splice site probably benign
IGL03173:Slc34a1 APN 13 55,561,089 (GRCm39) missense probably damaging 0.99
IGL03221:Slc34a1 APN 13 55,548,591 (GRCm39) missense probably benign 0.00
IGL03299:Slc34a1 APN 13 24,005,094 (GRCm39) critical splice donor site probably null
Rockies UTSW 13 24,003,317 (GRCm39) missense probably damaging 0.99
R0190:Slc34a1 UTSW 13 55,556,914 (GRCm39) missense probably benign 0.00
R0196:Slc34a1 UTSW 13 55,560,078 (GRCm39) missense probably damaging 0.99
R0362:Slc34a1 UTSW 13 55,550,711 (GRCm39) splice site probably null
R0622:Slc34a1 UTSW 13 23,996,594 (GRCm39) missense probably damaging 1.00
R1055:Slc34a1 UTSW 13 55,550,846 (GRCm39) missense probably benign 0.26
R1104:Slc34a1 UTSW 13 24,003,920 (GRCm39) missense probably damaging 0.99
R1243:Slc34a1 UTSW 13 55,559,944 (GRCm39) missense possibly damaging 0.85
R1414:Slc34a1 UTSW 13 55,548,524 (GRCm39) missense probably benign
R1530:Slc34a1 UTSW 13 24,003,052 (GRCm39) missense probably damaging 1.00
R1566:Slc34a1 UTSW 13 55,559,844 (GRCm39) critical splice acceptor site probably null
R1682:Slc34a1 UTSW 13 23,996,623 (GRCm39) missense probably damaging 0.96
R1732:Slc34a1 UTSW 13 55,561,233 (GRCm39) missense probably benign
R1901:Slc34a1 UTSW 13 55,548,963 (GRCm39) nonsense probably null
R2255:Slc34a1 UTSW 13 24,004,991 (GRCm39) missense probably benign 0.09
R2423:Slc34a1 UTSW 13 55,556,865 (GRCm39) missense possibly damaging 0.63
R2986:Slc34a1 UTSW 13 55,551,142 (GRCm39) missense probably benign 0.00
R3940:Slc34a1 UTSW 13 55,560,983 (GRCm39) missense probably damaging 1.00
R4003:Slc34a1 UTSW 13 55,550,474 (GRCm39) splice site probably benign
R4553:Slc34a1 UTSW 13 55,559,874 (GRCm39) splice site probably null
R4735:Slc34a1 UTSW 13 55,561,397 (GRCm39) missense probably benign 0.13
R4923:Slc34a1 UTSW 13 24,003,078 (GRCm39) missense probably benign 0.20
R5177:Slc34a1 UTSW 13 55,548,975 (GRCm39) missense probably damaging 0.99
R5193:Slc34a1 UTSW 13 24,003,845 (GRCm39) critical splice acceptor site probably null
R5321:Slc34a1 UTSW 13 23,996,614 (GRCm39) missense possibly damaging 0.95
R5334:Slc34a1 UTSW 13 24,003,034 (GRCm39) missense probably damaging 0.97
R5345:Slc34a1 UTSW 13 55,548,331 (GRCm39) missense probably benign
R5363:Slc34a1 UTSW 13 55,560,103 (GRCm39) missense probably damaging 1.00
R5363:Slc34a1 UTSW 13 55,551,081 (GRCm39) missense probably benign 0.16
R5377:Slc34a1 UTSW 13 23,996,575 (GRCm39) missense probably damaging 1.00
R5668:Slc34a1 UTSW 13 55,556,898 (GRCm39) missense possibly damaging 0.94
R5685:Slc34a1 UTSW 13 55,549,085 (GRCm39) critical splice donor site probably null
R5782:Slc34a1 UTSW 13 55,550,501 (GRCm39) missense possibly damaging 0.92
R5836:Slc34a1 UTSW 13 55,561,278 (GRCm39) missense probably benign 0.05
R6047:Slc34a1 UTSW 13 55,559,884 (GRCm39) missense probably damaging 1.00
R6165:Slc34a1 UTSW 13 23,999,053 (GRCm39) missense probably benign 0.00
R6280:Slc34a1 UTSW 13 24,006,377 (GRCm39) missense probably benign
R6311:Slc34a1 UTSW 13 23,999,005 (GRCm39) missense probably benign 0.40
R6323:Slc34a1 UTSW 13 23,998,969 (GRCm39) missense probably benign 0.00
R6476:Slc34a1 UTSW 13 23,996,569 (GRCm39) missense probably damaging 1.00
R6496:Slc34a1 UTSW 13 55,550,495 (GRCm39) missense probably benign 0.15
R6814:Slc34a1 UTSW 13 24,006,372 (GRCm39) missense possibly damaging 0.55
R7155:Slc34a1 UTSW 13 24,006,390 (GRCm39) missense probably benign 0.21
R7158:Slc34a1 UTSW 13 55,549,044 (GRCm39) missense probably damaging 0.99
R7188:Slc34a1 UTSW 13 24,006,348 (GRCm39) missense probably damaging 1.00
R7288:Slc34a1 UTSW 13 24,003,095 (GRCm39) missense probably benign 0.09
R7384:Slc34a1 UTSW 13 55,550,747 (GRCm39) missense probably benign 0.00
R7694:Slc34a1 UTSW 13 55,561,221 (GRCm39) missense probably benign 0.22
R7808:Slc34a1 UTSW 13 24,003,317 (GRCm39) missense probably damaging 0.99
R7937:Slc34a1 UTSW 13 23,996,648 (GRCm39) missense probably benign
R8444:Slc34a1 UTSW 13 24,003,061 (GRCm39) missense probably benign 0.00
R8447:Slc34a1 UTSW 13 24,006,309 (GRCm39) missense possibly damaging 0.50
R8932:Slc34a1 UTSW 13 24,004,184 (GRCm39) missense probably benign 0.00
R8977:Slc34a1 UTSW 13 55,556,815 (GRCm39) missense probably benign 0.01
R9635:Slc34a1 UTSW 13 55,556,940 (GRCm39) missense probably damaging 1.00
X0022:Slc34a1 UTSW 13 55,550,828 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGTGTGATTAGCAATGCAATATGC -3'
(R):5'- TAACTCACTCTGGAGGGTAGC -3'

Sequencing Primer
(F):5'- GCAAAGGACTTGTATAATTGGTAGG -3'
(R):5'- AGGGTAGCCTGGGATCTGC -3'
Posted On 2019-10-07