Mutagenetix > Incidental Mutation

Incidental Mutation 'R7462:Mroh2b'

578529

Institutional Source

Beutler Lab

Gene Symbol

Mroh2b

Ensembl Gene

ENSMUSG00000022155

Gene Name

maestro heat-like repeat family member 2B

Synonyms

4930455B06Rik, Heatr7b2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R7462 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4898737-4962205 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 4908627 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 243 (D243E)

Ref Sequence

ENSEMBL: ENSMUSP00000036148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045736]

AlphaFold

Q7M6Y6

Predicted Effect

probably damaging
Transcript: ENSMUST00000045736
AA Change: D243E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: D243E

Domain	Start	End	E-Value	Type
low complexity region	124	135	N/A	INTRINSIC
low complexity region	824	842	N/A	INTRINSIC
SCOP:d1gw5a_	937	1443	7e-15	SMART

Meta Mutation Damage Score

0.1210

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

98% (60/61)

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank2	G	C	3: 126,943,034	T3067S	unknown	Het
Ankrd28	T	C	14: 31,778,929	N35S	probably benign	Het
Bicra	A	T	7: 15,979,135	S996T	possibly damaging	Het
Btbd7	T	C	12: 102,837,722	E353G	possibly damaging	Het
Ccdc144b	T	A	3: 36,025,906		probably null	Het
Cdhr2	A	T	13: 54,726,739	I875F	probably damaging	Het
Ceacam5	A	T	7: 17,760,839	Y924F	probably damaging	Het
Clca4b	A	G	3: 144,922,860	I362T	probably benign	Het
Dchs2	A	G	3: 83,346,155		probably null	Het
Dlc1	T	A	8: 36,937,964	T224S	unknown	Het
Dmxl2	T	C	9: 54,366,632		probably null	Het
Dnajc1	A	G	2: 18,308,899	F137S	probably damaging	Het
E130311K13Rik	T	C	3: 63,929,301	T24A	probably benign	Het
Eya1	T	C	1: 14,231,414	E317G	probably null	Het
Fpr-rs6	A	G	17: 20,182,223	L292P	probably damaging	Het
Gca	G	T	2: 62,672,409	D54Y	possibly damaging	Het
Gm45861	G	A	8: 27,534,489		probably null	Het
Gm9573	T	C	17: 35,620,676	S873G	unknown	Het
Gtf2a1l	A	G	17: 88,694,138	T141A	possibly damaging	Het
Hgsnat	T	C	8: 25,957,213	N351S	probably benign	Het
Htr1f	A	T	16: 64,926,020	V303E	probably damaging	Het
Iars2	C	A	1: 185,322,866	W302L	probably damaging	Het
Igkv4-74	T	A	6: 69,185,116	Q23L	possibly damaging	Het
Il18	A	T	9: 50,565,373		probably benign	Het
Ints4	A	G	7: 97,506,128	D329G	probably benign	Het
Itsn1	T	C	16: 91,853,185	F249S	possibly damaging	Het
Ktn1	A	G	14: 47,694,632	E672G	probably null	Het
Lhx6	A	G	2: 36,084,071	I359T	possibly damaging	Het
Lrp1b	T	C	2: 41,113,029	E2030G		Het
Macf1	T	A	4: 123,492,763	K1114N	probably damaging	Het
Mbd5	A	G	2: 49,257,880	M701V	possibly damaging	Het
Mcemp1	A	T	8: 3,667,065	M69L	probably benign	Het
Mfsd4b2	T	A	10: 39,921,881	K159N	probably benign	Het
Mug1	A	T	6: 121,875,440	Q829L	probably benign	Het
Nav3	A	T	10: 109,823,578	V726E	probably damaging	Het
Nfib	T	C	4: 82,353,589	Q247R	probably benign	Het
Npbwr1	T	C	1: 5,916,932	N121S	probably damaging	Het
Olfr187	A	T	16: 59,036,016	C240*	probably null	Het
Olfr378	T	C	11: 73,425,470	D171G	probably benign	Het
Olfr691	T	A	7: 105,337,500	D72V	probably damaging	Het
Pkd1l3	A	G	8: 109,628,777	S726G	probably benign	Het
Ppip5k1	A	T	2: 121,336,751	V847D	probably damaging	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Ripor2	G	A	13: 24,696,307	V385M	unknown	Het
Rufy1	C	T	11: 50,407,828	V379M	possibly damaging	Het
S100a5	A	G	3: 90,609,900	K26R	probably damaging	Het
Sin3a	T	C	9: 57,095,525	S234P	probably benign	Het
Sirt7	G	A	11: 120,620,792	T225I	probably benign	Het
Slc17a2	A	T	13: 23,822,418	T476S	probably damaging	Het
Slc38a6	T	A	12: 73,350,577	M331K	probably benign	Het
Spam1	T	C	6: 24,796,908	I286T	probably damaging	Het
Syne1	T	A	10: 5,052,793	I214F	possibly damaging	Het
Tmtc1	A	G	6: 148,325,145	L427P	probably damaging	Het
Tpbg	G	A	9: 85,844,850	A291T	possibly damaging	Het
Zfp40	A	G	17: 23,178,388	F45S	possibly damaging	Het
Zfp451	C	T	1: 33,777,013	V619M	probably damaging	Het
Zim1	A	G	7: 6,677,812	L284P	probably damaging	Het
Zkscan4	A	G	13: 21,483,874	E165G	probably benign	Het
Zmynd11	T	A	13: 9,698,684	N154Y	probably benign	Het
Zscan12	A	T	13: 21,369,287	H427L	possibly damaging	Het

Other mutations in Mroh2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Mroh2b	APN	15	4899197	missense	probably benign
IGL00507:Mroh2b	APN	15	4962127	missense	probably damaging	1.00
IGL00548:Mroh2b	APN	15	4931316	missense	probably benign	0.35
IGL00902:Mroh2b	APN	15	4915222	missense	probably damaging	1.00
IGL00944:Mroh2b	APN	15	4951127	splice site	probably benign
IGL00954:Mroh2b	APN	15	4903054	missense	probably damaging	0.99
IGL01015:Mroh2b	APN	15	4941542	missense	probably damaging	1.00
IGL01134:Mroh2b	APN	15	4915152	missense	probably benign	0.00
IGL01337:Mroh2b	APN	15	4905024	missense	probably benign	0.38
IGL01780:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL01919:Mroh2b	APN	15	4923688	missense	probably benign	0.10
IGL02069:Mroh2b	APN	15	4904324	splice site	probably benign
IGL02146:Mroh2b	APN	15	4951294	splice site	probably null
IGL02221:Mroh2b	APN	15	4923641	missense	probably damaging	1.00
IGL02281:Mroh2b	APN	15	4952263	missense	probably benign	0.04
IGL02350:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02357:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02401:Mroh2b	APN	15	4900501	missense	possibly damaging	0.71
IGL02427:Mroh2b	APN	15	4951560	splice site	probably benign
IGL02432:Mroh2b	APN	15	4914186	missense	probably benign
IGL02582:Mroh2b	APN	15	4908515	missense	probably damaging	0.98
IGL02632:Mroh2b	APN	15	4931101	missense	probably damaging	0.99
IGL02741:Mroh2b	APN	15	4905632	missense	probably benign
IGL02811:Mroh2b	APN	15	4915236	missense	possibly damaging	0.55
IGL02826:Mroh2b	APN	15	4962148	missense	probably damaging	0.99
IGL03412:Mroh2b	APN	15	4944372	missense	probably benign	0.14
PIT4468001:Mroh2b	UTSW	15	4912812	missense	probably damaging	1.00
R0024:Mroh2b	UTSW	15	4925627	missense	probably damaging	1.00
R0333:Mroh2b	UTSW	15	4931118	missense	probably damaging	1.00
R0433:Mroh2b	UTSW	15	4941634	missense	probably benign	0.01
R0530:Mroh2b	UTSW	15	4934395	missense	probably damaging	0.97
R1411:Mroh2b	UTSW	15	4918317	missense	probably damaging	1.00
R1457:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1472:Mroh2b	UTSW	15	4948655	missense	probably benign	0.00
R1525:Mroh2b	UTSW	15	4951130	splice site	probably null
R1584:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1605:Mroh2b	UTSW	15	4945090	missense	probably benign	0.08
R1657:Mroh2b	UTSW	15	4931043	nonsense	probably null
R1671:Mroh2b	UTSW	15	4951294	splice site	probably null
R1698:Mroh2b	UTSW	15	4914140	missense	probably benign	0.02
R2002:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R2005:Mroh2b	UTSW	15	4917158	missense	probably damaging	1.00
R2077:Mroh2b	UTSW	15	4944966	missense	probably damaging	1.00
R2179:Mroh2b	UTSW	15	4921446	critical splice donor site	probably null
R2183:Mroh2b	UTSW	15	4918225	splice site	probably null
R3713:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3714:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3747:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3748:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3749:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3750:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3792:Mroh2b	UTSW	15	4923620	missense	probably damaging	1.00
R3872:Mroh2b	UTSW	15	4925061	nonsense	probably null
R4021:Mroh2b	UTSW	15	4925100	missense	possibly damaging	0.75
R4329:Mroh2b	UTSW	15	4931379	missense	probably damaging	0.99
R4456:Mroh2b	UTSW	15	4947925	missense	probably benign	0.21
R4592:Mroh2b	UTSW	15	4918290	missense	probably damaging	1.00
R4836:Mroh2b	UTSW	15	4904270	missense	probably damaging	1.00
R5050:Mroh2b	UTSW	15	4900450	missense	possibly damaging	0.82
R5230:Mroh2b	UTSW	15	4941522	missense	probably benign	0.07
R5342:Mroh2b	UTSW	15	4914133	nonsense	probably null
R5353:Mroh2b	UTSW	15	4917178	missense	probably damaging	1.00
R5368:Mroh2b	UTSW	15	4905572	missense	probably damaging	1.00
R5424:Mroh2b	UTSW	15	4941612	missense	probably damaging	0.98
R5484:Mroh2b	UTSW	15	4908981	missense	possibly damaging	0.92
R5999:Mroh2b	UTSW	15	4912884	splice site	probably null
R6046:Mroh2b	UTSW	15	4951281	missense	probably benign	0.01
R6081:Mroh2b	UTSW	15	4944377	missense	probably damaging	1.00
R6162:Mroh2b	UTSW	15	4915225	missense	probably damaging	1.00
R6165:Mroh2b	UTSW	15	4918350	missense	probably benign	0.23
R6240:Mroh2b	UTSW	15	4934644	missense	probably benign	0.38
R6487:Mroh2b	UTSW	15	4947239	missense	probably damaging	1.00
R6539:Mroh2b	UTSW	15	4905574	missense	probably damaging	1.00
R6616:Mroh2b	UTSW	15	4953282	missense	probably benign	0.36
R6663:Mroh2b	UTSW	15	4947935	missense	probably benign	0.21
R6820:Mroh2b	UTSW	15	4953274	missense	probably damaging	1.00
R6900:Mroh2b	UTSW	15	4908987	missense	probably benign	0.00
R6990:Mroh2b	UTSW	15	4912802	missense	possibly damaging	0.55
R7067:Mroh2b	UTSW	15	4900504	missense	probably benign	0.35
R7092:Mroh2b	UTSW	15	4934678	missense	possibly damaging	0.92
R7102:Mroh2b	UTSW	15	4948003	missense	probably benign	0.06
R7264:Mroh2b	UTSW	15	4921362	missense	possibly damaging	0.81
R7436:Mroh2b	UTSW	15	4941554	missense	probably benign	0.21
R7529:Mroh2b	UTSW	15	4949009	missense	probably damaging	1.00
R7575:Mroh2b	UTSW	15	4934605	missense	probably damaging	1.00
R7579:Mroh2b	UTSW	15	4931061	missense	probably benign	0.09
R7605:Mroh2b	UTSW	15	4945023	missense	probably damaging	1.00
R7624:Mroh2b	UTSW	15	4917131	missense	probably damaging	1.00
R7797:Mroh2b	UTSW	15	4949105	missense	probably benign	0.36
R7848:Mroh2b	UTSW	15	4938379	nonsense	probably null
R7952:Mroh2b	UTSW	15	4951211	missense	probably damaging	1.00
R7995:Mroh2b	UTSW	15	4921357	nonsense	probably null
R8088:Mroh2b	UTSW	15	4900503	missense	possibly damaging	0.57
R8207:Mroh2b	UTSW	15	4938410	missense	possibly damaging	0.95
R8242:Mroh2b	UTSW	15	4909040	missense	probably benign	0.04
R8248:Mroh2b	UTSW	15	4931104	missense	probably benign	0.40
R8258:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8259:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8304:Mroh2b	UTSW	15	4925637	missense	probably damaging	0.99
R8316:Mroh2b	UTSW	15	4951264	nonsense	probably null
R8345:Mroh2b	UTSW	15	4944326	missense	probably benign	0.09
R8507:Mroh2b	UTSW	15	4949090	missense	probably damaging	1.00
R8728:Mroh2b	UTSW	15	4905640	missense	probably damaging	1.00
R8747:Mroh2b	UTSW	15	4935300	missense	probably damaging	0.99
R8798:Mroh2b	UTSW	15	4948709	missense	probably damaging	1.00
R8814:Mroh2b	UTSW	15	4941625	missense	possibly damaging	0.61
R8856:Mroh2b	UTSW	15	4931028	nonsense	probably null
R8910:Mroh2b	UTSW	15	4931373	missense	probably benign	0.01
R8913:Mroh2b	UTSW	15	4917528	intron	probably benign
R8941:Mroh2b	UTSW	15	4962124	missense	possibly damaging	0.86
R9014:Mroh2b	UTSW	15	4899188	start codon destroyed	probably null	0.95
R9086:Mroh2b	UTSW	15	4953272	critical splice acceptor site	probably null
R9101:Mroh2b	UTSW	15	4900453	missense	probably benign	0.20
R9118:Mroh2b	UTSW	15	4962091	missense	possibly damaging	0.86
R9393:Mroh2b	UTSW	15	4951184	missense	probably benign
R9429:Mroh2b	UTSW	15	4934425	missense	probably damaging	1.00
R9431:Mroh2b	UTSW	15	4934470	missense	probably damaging	1.00
R9443:Mroh2b	UTSW	15	4944339	missense	probably damaging	1.00
R9447:Mroh2b	UTSW	15	4931341	missense	probably damaging	1.00
R9497:Mroh2b	UTSW	15	4921363	missense	probably damaging	0.98
R9588:Mroh2b	UTSW	15	4948648	missense	probably benign	0.00
R9631:Mroh2b	UTSW	15	4917074	missense	probably damaging	0.97
R9686:Mroh2b	UTSW	15	4945123	missense	probably benign	0.34
R9774:Mroh2b	UTSW	15	4914131	missense	probably benign	0.08
X0067:Mroh2b	UTSW	15	4951591	missense	possibly damaging	0.90
Z1177:Mroh2b	UTSW	15	4905005	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATAGGACAGTGTCATCAGTG -3'
(R):5'- GAACAAGCCCAACTGTGCTTC -3'

Sequencing Primer
(F):5'- AGGACAGTGTCATCAGTGATCATTG -3'
(R):5'- CATAGGGATTCTGATGTCACCAGC -3'

Posted On

2019-10-07