Incidental Mutation 'R7462:Gm9573'
ID578535
Institutional Source Beutler Lab
Gene Symbol Gm9573
Ensembl Gene ENSMUSG00000090588
Gene Namepredicted gene 9573
SynonymsMuc21, epiglycanin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7462 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location35617923-35626637 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35620676 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 873 (S873G)
Ref Sequence ENSEMBL: ENSMUSP00000130987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164502] [ENSMUST00000174521]
Predicted Effect unknown
Transcript: ENSMUST00000164502
AA Change: S873G
SMART Domains Protein: ENSMUSP00000130987
Gene: ENSMUSG00000090588
AA Change: S873G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 39 N/A INTRINSIC
low complexity region 42 59 N/A INTRINSIC
low complexity region 76 144 N/A INTRINSIC
low complexity region 149 578 N/A INTRINSIC
low complexity region 580 653 N/A INTRINSIC
low complexity region 655 1179 N/A INTRINSIC
low complexity region 1183 1373 N/A INTRINSIC
low complexity region 1383 1436 N/A INTRINSIC
low complexity region 1438 1479 N/A INTRINSIC
Pfam:Epiglycanin_C 1518 1605 3.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174521
SMART Domains Protein: ENSMUSP00000134221
Gene: ENSMUSG00000090509

DomainStartEndE-ValueType
Pfam:SFTA2 80 117 9.2e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 G C 3: 126,943,034 T3067S unknown Het
Ankrd28 T C 14: 31,778,929 N35S probably benign Het
Bicra A T 7: 15,979,135 S996T possibly damaging Het
Btbd7 T C 12: 102,837,722 E353G possibly damaging Het
Ccdc144b T A 3: 36,025,906 probably null Het
Cdhr2 A T 13: 54,726,739 I875F probably damaging Het
Ceacam5 A T 7: 17,760,839 Y924F probably damaging Het
Clca4b A G 3: 144,922,860 I362T probably benign Het
Dchs2 A G 3: 83,346,155 probably null Het
Dlc1 T A 8: 36,937,964 T224S unknown Het
Dmxl2 T C 9: 54,366,632 probably null Het
Dnajc1 A G 2: 18,308,899 F137S probably damaging Het
E130311K13Rik T C 3: 63,929,301 T24A probably benign Het
Eya1 T C 1: 14,231,414 E317G probably null Het
Fpr-rs6 A G 17: 20,182,223 L292P probably damaging Het
Gca G T 2: 62,672,409 D54Y possibly damaging Het
Gm45861 G A 8: 27,534,489 probably null Het
Gtf2a1l A G 17: 88,694,138 T141A possibly damaging Het
Hgsnat T C 8: 25,957,213 N351S probably benign Het
Htr1f A T 16: 64,926,020 V303E probably damaging Het
Iars2 C A 1: 185,322,866 W302L probably damaging Het
Igkv4-74 T A 6: 69,185,116 Q23L possibly damaging Het
Il18 A T 9: 50,565,373 probably benign Het
Ints4 A G 7: 97,506,128 D329G probably benign Het
Itsn1 T C 16: 91,853,185 F249S possibly damaging Het
Ktn1 A G 14: 47,694,632 E672G probably null Het
Lhx6 A G 2: 36,084,071 I359T possibly damaging Het
Lrp1b T C 2: 41,113,029 E2030G Het
Macf1 T A 4: 123,492,763 K1114N probably damaging Het
Mbd5 A G 2: 49,257,880 M701V possibly damaging Het
Mcemp1 A T 8: 3,667,065 M69L probably benign Het
Mfsd4b2 T A 10: 39,921,881 K159N probably benign Het
Mroh2b T A 15: 4,908,627 D243E probably damaging Het
Mug1 A T 6: 121,875,440 Q829L probably benign Het
Nav3 A T 10: 109,823,578 V726E probably damaging Het
Nfib T C 4: 82,353,589 Q247R probably benign Het
Npbwr1 T C 1: 5,916,932 N121S probably damaging Het
Olfr187 A T 16: 59,036,016 C240* probably null Het
Olfr378 T C 11: 73,425,470 D171G probably benign Het
Olfr691 T A 7: 105,337,500 D72V probably damaging Het
Pkd1l3 A G 8: 109,628,777 S726G probably benign Het
Ppip5k1 A T 2: 121,336,751 V847D probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Ripor2 G A 13: 24,696,307 V385M unknown Het
Rufy1 C T 11: 50,407,828 V379M possibly damaging Het
S100a5 A G 3: 90,609,900 K26R probably damaging Het
Sin3a T C 9: 57,095,525 S234P probably benign Het
Sirt7 G A 11: 120,620,792 T225I probably benign Het
Slc17a2 A T 13: 23,822,418 T476S probably damaging Het
Slc38a6 T A 12: 73,350,577 M331K probably benign Het
Spam1 T C 6: 24,796,908 I286T probably damaging Het
Syne1 T A 10: 5,052,793 I214F possibly damaging Het
Tmtc1 A G 6: 148,325,145 L427P probably damaging Het
Tpbg G A 9: 85,844,850 A291T possibly damaging Het
Zfp40 A G 17: 23,178,388 F45S possibly damaging Het
Zfp451 C T 1: 33,777,013 V619M probably damaging Het
Zim1 A G 7: 6,677,812 L284P probably damaging Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Zmynd11 T A 13: 9,698,684 N154Y probably benign Het
Zscan12 A T 13: 21,369,287 H427L possibly damaging Het
Other mutations in Gm9573
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Gm9573 UTSW 17 35622121 intron probably benign
R0334:Gm9573 UTSW 17 35622722 intron probably benign
R0946:Gm9573 UTSW 17 35618213 missense probably benign 0.32
R1117:Gm9573 UTSW 17 35620028 intron probably benign
R1345:Gm9573 UTSW 17 35621597 intron probably benign
R1697:Gm9573 UTSW 17 35620648 intron probably benign
R1750:Gm9573 UTSW 17 35621048 intron probably benign
R1756:Gm9573 UTSW 17 35619239 intron probably benign
R1946:Gm9573 UTSW 17 35622524 intron probably benign
R1978:Gm9573 UTSW 17 35622965 intron probably benign
R1991:Gm9573 UTSW 17 35618708 missense probably benign 0.32
R1992:Gm9573 UTSW 17 35618708 missense probably benign 0.32
R2063:Gm9573 UTSW 17 35621405 intron probably benign
R2356:Gm9573 UTSW 17 35621671 intron probably benign
R2866:Gm9573 UTSW 17 35619707 intron probably benign
R3826:Gm9573 UTSW 17 35621612 intron probably benign
R4020:Gm9573 UTSW 17 35620061 intron probably benign
R4474:Gm9573 UTSW 17 35620604 intron probably benign
R4677:Gm9573 UTSW 17 35619707 intron probably benign
R4786:Gm9573 UTSW 17 35619329 intron probably benign
R5071:Gm9573 UTSW 17 35620552 intron probably benign
R5173:Gm9573 UTSW 17 35620741 intron probably benign
R5283:Gm9573 UTSW 17 35621332 intron probably benign
R5446:Gm9573 UTSW 17 35622503 intron probably benign
R5542:Gm9573 UTSW 17 35622503 intron probably benign
R5716:Gm9573 UTSW 17 35620783 intron probably benign
R5913:Gm9573 UTSW 17 35623231 intron probably benign
R6011:Gm9573 UTSW 17 35622182 intron probably benign
R6198:Gm9573 UTSW 17 35620916 intron probably benign
R6394:Gm9573 UTSW 17 35620166 intron probably benign
R6786:Gm9573 UTSW 17 35623165 intron probably benign
R6940:Gm9573 UTSW 17 35623226 intron probably benign
R7082:Gm9573 UTSW 17 35621201 missense unknown
R7103:Gm9573 UTSW 17 35621540 missense unknown
R7110:Gm9573 UTSW 17 35622618 intron probably benign
R7139:Gm9573 UTSW 17 35622633 intron probably benign
R7165:Gm9573 UTSW 17 35621978 missense unknown
R7200:Gm9573 UTSW 17 35622633 intron probably benign
R7204:Gm9573 UTSW 17 35621213 intron probably benign
R7289:Gm9573 UTSW 17 35618869 missense unknown
R7290:Gm9573 UTSW 17 35618869 missense unknown
R7295:Gm9573 UTSW 17 35618869 missense unknown
R7319:Gm9573 UTSW 17 35622043 intron probably benign
R7529:Gm9573 UTSW 17 35619231 missense unknown
R7718:Gm9573 UTSW 17 35622836 missense unknown
R7762:Gm9573 UTSW 17 35622085 missense unknown
R7788:Gm9573 UTSW 17 35618906 missense unknown
R7798:Gm9573 UTSW 17 35621254 missense unknown
RF025:Gm9573 UTSW 17 35622879 intron probably benign
Predicted Primers PCR Primer
(F):5'- CATAGATCCTGAGGCAGAGC -3'
(R):5'- TGTATCCAGCACTGCCTCAG -3'

Sequencing Primer
(F):5'- TCCTGAGGCAGAGCTGGATG -3'
(R):5'- AGGCTCTACACCTACCCTG -3'
Posted On2019-10-07