Incidental Mutation 'R7462:Gtf2a1l'
ID578536
Institutional Source Beutler Lab
Gene Symbol Gtf2a1l
Ensembl Gene ENSMUSG00000024154
Gene Namegeneral transcription factor IIA, 1-like
SynonymsGtf2a1lf, 1700011N16Rik, Alf
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.518) question?
Stock #R7462 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location88668660-88715152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88694138 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 141 (T141A)
Ref Sequence ENSEMBL: ENSMUSP00000024970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024970] [ENSMUST00000161481]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024970
AA Change: T141A

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000024970
Gene: ENSMUSG00000024154
AA Change: T141A

DomainStartEndE-ValueType
TFIIA 9 468 6.87e-202 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000124286
Gene: ENSMUSG00000024154
AA Change: T94A

DomainStartEndE-ValueType
Pfam:TFIIA 9 76 3.2e-29 PFAM
Pfam:TFIIA 70 243 3e-13 PFAM
Meta Mutation Damage Score 0.1118 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The assembly and stability of the RNA polymerase II transcription pre-initiation complex on a eukaryotic core promoter involve the effects of transcription factor IIA (TFIIA) on the interaction between TATA-binding protein (TBP) and DNA. This gene encodes a germ cell-specific counterpart of the large (alpha/beta) subunit of general transcription factor TFIIA that is able to stabilize the binding of TBP to DNA and may be uniquely important to testis biology. Alternative splicing for this locus has been observed and two variants, encoding distinct isoforms, have been identified. Co-transcription of this gene and the neighboring upstream gene generates a rare transcript (SALF), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 G C 3: 126,943,034 T3067S unknown Het
Ankrd28 T C 14: 31,778,929 N35S probably benign Het
Bicra A T 7: 15,979,135 S996T possibly damaging Het
Btbd7 T C 12: 102,837,722 E353G possibly damaging Het
Ccdc144b T A 3: 36,025,906 probably null Het
Cdhr2 A T 13: 54,726,739 I875F probably damaging Het
Ceacam5 A T 7: 17,760,839 Y924F probably damaging Het
Clca4b A G 3: 144,922,860 I362T probably benign Het
Dchs2 A G 3: 83,346,155 probably null Het
Dlc1 T A 8: 36,937,964 T224S unknown Het
Dmxl2 T C 9: 54,366,632 probably null Het
Dnajc1 A G 2: 18,308,899 F137S probably damaging Het
E130311K13Rik T C 3: 63,929,301 T24A probably benign Het
Eya1 T C 1: 14,231,414 E317G probably null Het
Fpr-rs6 A G 17: 20,182,223 L292P probably damaging Het
Gca G T 2: 62,672,409 D54Y possibly damaging Het
Gm45861 G A 8: 27,534,489 probably null Het
Gm9573 T C 17: 35,620,676 S873G unknown Het
Hgsnat T C 8: 25,957,213 N351S probably benign Het
Htr1f A T 16: 64,926,020 V303E probably damaging Het
Iars2 C A 1: 185,322,866 W302L probably damaging Het
Igkv4-74 T A 6: 69,185,116 Q23L possibly damaging Het
Il18 A T 9: 50,565,373 probably benign Het
Ints4 A G 7: 97,506,128 D329G probably benign Het
Itsn1 T C 16: 91,853,185 F249S possibly damaging Het
Ktn1 A G 14: 47,694,632 E672G probably null Het
Lhx6 A G 2: 36,084,071 I359T possibly damaging Het
Lrp1b T C 2: 41,113,029 E2030G Het
Macf1 T A 4: 123,492,763 K1114N probably damaging Het
Mbd5 A G 2: 49,257,880 M701V possibly damaging Het
Mcemp1 A T 8: 3,667,065 M69L probably benign Het
Mfsd4b2 T A 10: 39,921,881 K159N probably benign Het
Mroh2b T A 15: 4,908,627 D243E probably damaging Het
Mug1 A T 6: 121,875,440 Q829L probably benign Het
Nav3 A T 10: 109,823,578 V726E probably damaging Het
Nfib T C 4: 82,353,589 Q247R probably benign Het
Npbwr1 T C 1: 5,916,932 N121S probably damaging Het
Olfr187 A T 16: 59,036,016 C240* probably null Het
Olfr378 T C 11: 73,425,470 D171G probably benign Het
Olfr691 T A 7: 105,337,500 D72V probably damaging Het
Pkd1l3 A G 8: 109,628,777 S726G probably benign Het
Ppip5k1 A T 2: 121,336,751 V847D probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Ripor2 G A 13: 24,696,307 V385M unknown Het
Rufy1 C T 11: 50,407,828 V379M possibly damaging Het
S100a5 A G 3: 90,609,900 K26R probably damaging Het
Sin3a T C 9: 57,095,525 S234P probably benign Het
Sirt7 G A 11: 120,620,792 T225I probably benign Het
Slc17a2 A T 13: 23,822,418 T476S probably damaging Het
Slc38a6 T A 12: 73,350,577 M331K probably benign Het
Spam1 T C 6: 24,796,908 I286T probably damaging Het
Syne1 T A 10: 5,052,793 I214F possibly damaging Het
Tmtc1 A G 6: 148,325,145 L427P probably damaging Het
Tpbg G A 9: 85,844,850 A291T possibly damaging Het
Zfp40 A G 17: 23,178,388 F45S possibly damaging Het
Zfp451 C T 1: 33,777,013 V619M probably damaging Het
Zim1 A G 7: 6,677,812 L284P probably damaging Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Zmynd11 T A 13: 9,698,684 N154Y probably benign Het
Zscan12 A T 13: 21,369,287 H427L possibly damaging Het
Other mutations in Gtf2a1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Gtf2a1l APN 17 88694295 missense probably damaging 1.00
IGL00928:Gtf2a1l APN 17 88694462 missense probably benign 0.09
IGL00974:Gtf2a1l APN 17 88714949 missense probably damaging 1.00
IGL01024:Gtf2a1l APN 17 88671291 missense probably damaging 1.00
IGL02429:Gtf2a1l APN 17 88668713 start codon destroyed probably null 0.61
IGL02658:Gtf2a1l APN 17 88668718 missense probably benign 0.01
IGL03377:Gtf2a1l APN 17 88711593 missense probably benign 0.03
R0848:Gtf2a1l UTSW 17 88694229 missense probably damaging 0.99
R0899:Gtf2a1l UTSW 17 88668724 missense possibly damaging 0.56
R1435:Gtf2a1l UTSW 17 88694315 missense probably damaging 1.00
R1716:Gtf2a1l UTSW 17 88694580 missense probably benign 0.06
R1861:Gtf2a1l UTSW 17 88714954 missense probably damaging 1.00
R2301:Gtf2a1l UTSW 17 88711472 missense probably benign
R2906:Gtf2a1l UTSW 17 88694655 missense possibly damaging 0.92
R4281:Gtf2a1l UTSW 17 88711637 missense possibly damaging 0.95
R4289:Gtf2a1l UTSW 17 88694456 missense probably damaging 0.98
R4771:Gtf2a1l UTSW 17 88690020 missense probably benign 0.23
R4904:Gtf2a1l UTSW 17 88690043 critical splice donor site probably null
R4941:Gtf2a1l UTSW 17 88714922 missense probably damaging 1.00
R5106:Gtf2a1l UTSW 17 88694645 missense possibly damaging 0.95
R6003:Gtf2a1l UTSW 17 88694103 missense probably damaging 1.00
R6035:Gtf2a1l UTSW 17 88711534 missense probably benign 0.00
R6035:Gtf2a1l UTSW 17 88711534 missense probably benign 0.00
R6128:Gtf2a1l UTSW 17 88694658 missense probably null 0.94
R6246:Gtf2a1l UTSW 17 88671547 missense probably benign 0.09
R6481:Gtf2a1l UTSW 17 88711625 missense probably benign 0.09
R7344:Gtf2a1l UTSW 17 88694103 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGTGAGCATACCTGTGG -3'
(R):5'- ATGTGTCCTGTCCACTGGAG -3'

Sequencing Primer
(F):5'- TGAGCATACCTGTGGACATC -3'
(R):5'- TCCTGTCCACTGGAGGAGGATG -3'
Posted On2019-10-07