Mutagenetix > Incidental Mutation

Incidental Mutation 'R7463:Zer1'

578541

Institutional Source

Beutler Lab

Gene Symbol

Zer1

Ensembl Gene

ENSMUSG00000039686

Gene Name

zyg-11 related, cell cycle regulator

Synonyms

C230075L19Rik, Zyg11bl

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.210) question?

Stock #

R7463 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30097283-30124585 bp(-) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

A to T at 30113437 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000109307 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044751] [ENSMUST00000113677]

AlphaFold

Q80ZJ6

Predicted Effect

probably benign
Transcript: ENSMUST00000044751

SMART Domains

Protein: ENSMUSP00000046441
Gene: ENSMUSG00000039686

Domain	Start	End	E-Value	Type
SCOP:d1jdha_	405	774	3e-15	SMART
Blast:ARM	440	480	2e-18	BLAST
Blast:ARM	524	569	4e-24	BLAST
Blast:ARM	571	613	6e-22	BLAST
Blast:ARM	617	656	7e-8	BLAST
Blast:ARM	686	724	6e-18	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000113677

SMART Domains

Protein: ENSMUSP00000109307
Gene: ENSMUSG00000039686

Domain	Start	End	E-Value	Type
SCOP:d1jdha_	392	761	3e-15	SMART
Blast:ARM	427	467	2e-18	BLAST
Blast:ARM	511	556	4e-24	BLAST
Blast:ARM	558	600	2e-21	BLAST
Blast:ARM	604	643	7e-8	BLAST
Blast:ARM	673	711	6e-18	BLAST

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.7%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The encoded protein contains three leucine-rich repeat motifs. [provided by RefSeq, Nov 2012]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	A	T	17: 46,323,772	V435E	probably damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adcy2	T	C	13: 68,730,280	D413G	probably damaging	Het
Adgrg6	T	A	10: 14,434,396	D727V	possibly damaging	Het
Aebp2	C	T	6: 140,637,726	Q309*	probably null	Het
Amy1	A	T	3: 113,569,884	C43*	probably null	Het
Bpifc	T	C	10: 85,979,334	E256G	probably benign	Het
Bysl	A	T	17: 47,602,471	S296T	probably benign	Het
Carmil3	C	T	14: 55,502,396	P980L	probably damaging	Het
Coch	T	A	12: 51,593,625	M1K	probably null	Het
Cpt2	A	T	4: 107,908,157	F137I	probably damaging	Het
Crem	T	C	18: 3,295,094	I112V	probably benign	Het
Cul9	A	G	17: 46,520,476		probably null	Het
Cyp3a41a	T	A	5: 145,713,564	I90F	probably damaging	Het
Cyp4f16	C	T	17: 32,550,787	A457V	possibly damaging	Het
Ddx6	A	G	9: 44,628,729	E318G	probably damaging	Het
Dip2b	A	G	15: 100,154,157	E213G	probably benign	Het
Dlx5	T	C	6: 6,878,316	H238R	probably damaging	Het
Dnaic2	A	C	11: 114,754,406	I556L	probably benign	Het
Dnmt1	C	T	9: 20,912,225	V1147M	possibly damaging	Het
Egf	G	T	3: 129,740,015	Q59K	probably benign	Het
Ermp1	A	T	19: 29,646,262	Y109*	probably null	Het
Fer1l6	T	A	15: 58,573,601	Y573*	probably null	Het
Fmnl1	T	C	11: 103,193,128	L503P	probably damaging	Het
Gnptab	T	G	10: 88,431,389	I447M	probably damaging	Het
Hgf	G	A	5: 16,578,450	D253N	probably benign	Het
Hjurp	CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT	C	1: 88,266,277		probably benign	Het
Igf2r	T	C	17: 12,710,645	T958A	probably benign	Het
Kcnd2	T	A	6: 21,216,498	L67Q	probably damaging	Het
Kif5a	A	G	10: 127,243,724	V248A	probably damaging	Het
Krt33b	A	G	11: 100,029,563	I88T	probably damaging	Het
Lhx2	G	A	2: 38,351,846	E25K	possibly damaging	Het
Mex3d	C	T	10: 80,381,698	G562R		Het
Myom2	A	T	8: 15,117,679	Y1088F	probably null	Het
Ncapg	T	A	5: 45,694,092		probably null	Het
Nudc	A	C	4: 133,534,403	V190G	possibly damaging	Het
Obscn	G	T	11: 59,122,860	R1054S	probably benign	Het
Olfr1045	T	C	2: 86,197,838	M305V	probably benign	Het
Olfr1510	A	G	14: 52,410,711	W54R	probably benign	Het
Olfr651	T	C	7: 104,553,482	S188P	possibly damaging	Het
Olfr683	T	A	7: 105,143,937	M119L	probably benign	Het
Olfr710	A	T	7: 106,944,173	V276E	probably damaging	Het
Olfr979	A	G	9: 40,000,564	V221A	probably benign	Het
Pcdh10	A	T	3: 45,383,572	R891S	possibly damaging	Het
Pcdh15	C	T	10: 74,631,770	S1873L	possibly damaging	Het
Pcdh7	A	G	5: 57,720,998	K632E	probably benign	Het
Pcdhgb8	G	A	18: 37,763,427	A517T	probably damaging	Het
Ptgr2	A	T	12: 84,292,298		probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Racgap1	T	A	15: 99,642,958	T4S	probably benign	Het
Rb1cc1	A	G	1: 6,249,180	H941R	probably benign	Het
Reln	T	C	5: 22,103,435	H312R	probably damaging	Het
Rnf166	T	A	8: 122,467,987	H208L	probably damaging	Het
Theg	T	C	10: 79,576,715	E314G	probably damaging	Het
Timeless	T	C	10: 128,250,426	S999P	probably benign	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tor1aip1	A	T	1: 156,007,609	H349Q	possibly damaging	Het
Ttn	T	A	2: 76,920,460	E3415V	probably benign	Het
Vmn2r102	A	T	17: 19,676,624	N78Y	probably damaging	Het
Wdr11	A	T	7: 129,607,086	D427V	probably damaging	Het
Zfp516	T	A	18: 82,957,108	M477K	probably benign	Het

Other mutations in Zer1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01098:Zer1	APN	2	30108220	critical splice donor site	probably null
IGL01630:Zer1	APN	2	30101831	missense	probably damaging	1.00
IGL02126:Zer1	APN	2	30104916	missense	probably benign	0.10
IGL02338:Zer1	APN	2	30113393	missense	probably damaging	1.00
IGL02817:Zer1	APN	2	30103394	missense	probably damaging	0.99
PIT4402001:Zer1	UTSW	2	30101120	missense	probably damaging	0.96
PIT4495001:Zer1	UTSW	2	30103543	missense	probably benign	0.01
R0390:Zer1	UTSW	2	30108213	splice site	probably benign
R0506:Zer1	UTSW	2	30101807	missense	probably damaging	1.00
R0606:Zer1	UTSW	2	30104797	splice site	probably benign
R0928:Zer1	UTSW	2	30101763	critical splice donor site	probably null
R1167:Zer1	UTSW	2	30108246	missense	probably benign	0.00
R1819:Zer1	UTSW	2	30110218	missense	probably benign	0.18
R2040:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2041:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2042:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2092:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2168:Zer1	UTSW	2	30104875	missense	probably damaging	1.00
R2243:Zer1	UTSW	2	30101127	missense	probably damaging	0.99
R2254:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2255:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2311:Zer1	UTSW	2	30101822	missense	probably damaging	0.99
R2993:Zer1	UTSW	2	30101897	missense	probably damaging	1.00
R3010:Zer1	UTSW	2	30113285	missense	probably benign	0.13
R3731:Zer1	UTSW	2	30110911	missense	probably benign	0.44
R4038:Zer1	UTSW	2	30107523	missense	probably damaging	1.00
R5241:Zer1	UTSW	2	30104970	missense	probably damaging	1.00
R5433:Zer1	UTSW	2	30100986	intron	probably benign
R5443:Zer1	UTSW	2	30110996	missense	probably damaging	1.00
R5524:Zer1	UTSW	2	30104854	missense	probably damaging	1.00
R5936:Zer1	UTSW	2	30107667	missense	probably damaging	0.97
R5999:Zer1	UTSW	2	30104997	missense	probably damaging	1.00
R6598:Zer1	UTSW	2	30113274	missense	probably damaging	1.00
R6965:Zer1	UTSW	2	30101047	missense	possibly damaging	0.87
R7030:Zer1	UTSW	2	30111021	missense	probably benign	0.00
R7190:Zer1	UTSW	2	30103432	missense	probably damaging	1.00
R7218:Zer1	UTSW	2	30105012	missense	probably damaging	1.00
R7252:Zer1	UTSW	2	30101892	missense	probably damaging	0.99
R7383:Zer1	UTSW	2	30111241	missense	probably damaging	1.00
R7417:Zer1	UTSW	2	30102822	missense	probably damaging	1.00
R7459:Zer1	UTSW	2	30113325	missense	probably damaging	1.00
R7466:Zer1	UTSW	2	30101484	splice site	probably null
R7477:Zer1	UTSW	2	30107976	missense	probably null	0.34
R7719:Zer1	UTSW	2	30111231	missense	probably damaging	1.00
R7813:Zer1	UTSW	2	30110373	missense	probably damaging	1.00
R7976:Zer1	UTSW	2	30107508	missense	probably damaging	0.99
R8239:Zer1	UTSW	2	30101135	critical splice acceptor site	probably null
R8350:Zer1	UTSW	2	30101850	missense	probably damaging	1.00
R8404:Zer1	UTSW	2	30105023	critical splice acceptor site	probably null
R8842:Zer1	UTSW	2	30111050	missense	possibly damaging	0.65
R8896:Zer1	UTSW	2	30103418	missense	probably damaging	0.99
R8906:Zer1	UTSW	2	30111023	missense	probably benign	0.31
R8929:Zer1	UTSW	2	30110869	missense	probably damaging	1.00
R9050:Zer1	UTSW	2	30111282	missense	probably damaging	1.00
R9066:Zer1	UTSW	2	30110674	missense	probably damaging	1.00
R9277:Zer1	UTSW	2	30111285	missense	probably benign	0.00
R9322:Zer1	UTSW	2	30110911	missense	probably benign	0.00
R9577:Zer1	UTSW	2	30101038	missense	probably damaging	1.00
R9733:Zer1	UTSW	2	30107631	missense	probably benign	0.00
X0026:Zer1	UTSW	2	30104895	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCACTGGGCAAGAAGATGTC -3'
(R):5'- GCATGACCCAGTGTTATATGAGAAC -3'

Sequencing Primer
(F):5'- AGATGTCTGGATGCAGCCG -3'
(R):5'- CTCAGGCTGGTCTGGAATTCC -3'

Posted On

2019-10-07