Incidental Mutation 'R7463:Zer1'
ID 578541
Institutional Source Beutler Lab
Gene Symbol Zer1
Ensembl Gene ENSMUSG00000039686
Gene Name zyg-11 related, cell cycle regulator
Synonyms Zyg11bl, C230075L19Rik
MMRRC Submission 045537-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.134) question?
Stock # R7463 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 29987295-30014597 bp(-) (GRCm39)
Type of Mutation start gained
DNA Base Change (assembly) A to T at 30003449 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044751] [ENSMUST00000113677]
AlphaFold Q80ZJ6
Predicted Effect probably benign
Transcript: ENSMUST00000044751
SMART Domains Protein: ENSMUSP00000046441
Gene: ENSMUSG00000039686

DomainStartEndE-ValueType
SCOP:d1jdha_ 405 774 3e-15 SMART
Blast:ARM 440 480 2e-18 BLAST
Blast:ARM 524 569 4e-24 BLAST
Blast:ARM 571 613 6e-22 BLAST
Blast:ARM 617 656 7e-8 BLAST
Blast:ARM 686 724 6e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113677
SMART Domains Protein: ENSMUSP00000109307
Gene: ENSMUSG00000039686

DomainStartEndE-ValueType
SCOP:d1jdha_ 392 761 3e-15 SMART
Blast:ARM 427 467 2e-18 BLAST
Blast:ARM 511 556 4e-24 BLAST
Blast:ARM 558 600 2e-21 BLAST
Blast:ARM 604 643 7e-8 BLAST
Blast:ARM 673 711 6e-18 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The encoded protein contains three leucine-rich repeat motifs. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,634,698 (GRCm39) V435E probably damaging Het
Acta2 G A 19: 34,229,931 (GRCm39) T8I probably benign Het
Adcy2 T C 13: 68,878,399 (GRCm39) D413G probably damaging Het
Adgrg6 T A 10: 14,310,140 (GRCm39) D727V possibly damaging Het
Aebp2 C T 6: 140,583,452 (GRCm39) Q309* probably null Het
Amy1 A T 3: 113,363,533 (GRCm39) C43* probably null Het
Bpifc T C 10: 85,815,198 (GRCm39) E256G probably benign Het
Bysl A T 17: 47,913,396 (GRCm39) S296T probably benign Het
Carmil3 C T 14: 55,739,853 (GRCm39) P980L probably damaging Het
Coch T A 12: 51,640,408 (GRCm39) M1K probably null Het
Cpt2 A T 4: 107,765,354 (GRCm39) F137I probably damaging Het
Crem T C 18: 3,295,094 (GRCm39) I112V probably benign Het
Cul9 A G 17: 46,831,402 (GRCm39) probably null Het
Cyp3a41a T A 5: 145,650,374 (GRCm39) I90F probably damaging Het
Cyp4f16 C T 17: 32,769,761 (GRCm39) A457V possibly damaging Het
Ddx6 A G 9: 44,540,026 (GRCm39) E318G probably damaging Het
Dip2b A G 15: 100,052,038 (GRCm39) E213G probably benign Het
Dlx5 T C 6: 6,878,316 (GRCm39) H238R probably damaging Het
Dnai2 A C 11: 114,645,232 (GRCm39) I556L probably benign Het
Dnmt1 C T 9: 20,823,521 (GRCm39) V1147M possibly damaging Het
Egf G T 3: 129,533,664 (GRCm39) Q59K probably benign Het
Ermp1 A T 19: 29,623,662 (GRCm39) Y109* probably null Het
Fer1l6 T A 15: 58,445,450 (GRCm39) Y573* probably null Het
Fmnl1 T C 11: 103,083,954 (GRCm39) L503P probably damaging Het
Gnptab T G 10: 88,267,251 (GRCm39) I447M probably damaging Het
Hgf G A 5: 16,783,448 (GRCm39) D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Igf2r T C 17: 12,929,532 (GRCm39) T958A probably benign Het
Kcnd2 T A 6: 21,216,497 (GRCm39) L67Q probably damaging Het
Kif5a A G 10: 127,079,593 (GRCm39) V248A probably damaging Het
Krt33b A G 11: 99,920,389 (GRCm39) I88T probably damaging Het
Lhx2 G A 2: 38,241,858 (GRCm39) E25K possibly damaging Het
Mex3d C T 10: 80,217,532 (GRCm39) G562R Het
Myom2 A T 8: 15,167,679 (GRCm39) Y1088F probably null Het
Ncapg T A 5: 45,851,434 (GRCm39) probably null Het
Nudc A C 4: 133,261,714 (GRCm39) V190G possibly damaging Het
Obscn G T 11: 59,013,686 (GRCm39) R1054S probably benign Het
Or10g1 A G 14: 52,648,168 (GRCm39) W54R probably benign Het
Or10g9 A G 9: 39,911,860 (GRCm39) V221A probably benign Het
Or2d4 A T 7: 106,543,380 (GRCm39) V276E probably damaging Het
Or52h9 T C 7: 104,202,689 (GRCm39) S188P possibly damaging Het
Or56a5 T A 7: 104,793,144 (GRCm39) M119L probably benign Het
Or8j3 T C 2: 86,028,182 (GRCm39) M305V probably benign Het
Pcdh10 A T 3: 45,338,007 (GRCm39) R891S possibly damaging Het
Pcdh15 C T 10: 74,467,602 (GRCm39) S1873L possibly damaging Het
Pcdh7 A G 5: 57,878,340 (GRCm39) K632E probably benign Het
Pcdhgb8 G A 18: 37,896,480 (GRCm39) A517T probably damaging Het
Ptgr2 A T 12: 84,339,072 (GRCm39) probably benign Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Racgap1 T A 15: 99,540,839 (GRCm39) T4S probably benign Het
Rb1cc1 A G 1: 6,319,404 (GRCm39) H941R probably benign Het
Reln T C 5: 22,308,433 (GRCm39) H312R probably damaging Het
Rnf166 T A 8: 123,194,726 (GRCm39) H208L probably damaging Het
Spmap2 T C 10: 79,412,549 (GRCm39) E314G probably damaging Het
Timeless T C 10: 128,086,295 (GRCm39) S999P probably benign Het
Tmem94 G T 11: 115,677,082 (GRCm39) R118L possibly damaging Het
Tor1aip1 A T 1: 155,883,355 (GRCm39) H349Q possibly damaging Het
Ttn T A 2: 76,750,804 (GRCm39) E3415V probably benign Het
Vmn2r102 A T 17: 19,896,886 (GRCm39) N78Y probably damaging Het
Wdr11 A T 7: 129,208,810 (GRCm39) D427V probably damaging Het
Zfp516 T A 18: 82,975,233 (GRCm39) M477K probably benign Het
Other mutations in Zer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Zer1 APN 2 29,998,232 (GRCm39) critical splice donor site probably null
IGL01630:Zer1 APN 2 29,991,843 (GRCm39) missense probably damaging 1.00
IGL02126:Zer1 APN 2 29,994,928 (GRCm39) missense probably benign 0.10
IGL02338:Zer1 APN 2 30,003,405 (GRCm39) missense probably damaging 1.00
IGL02817:Zer1 APN 2 29,993,406 (GRCm39) missense probably damaging 0.99
PIT4402001:Zer1 UTSW 2 29,991,132 (GRCm39) missense probably damaging 0.96
PIT4495001:Zer1 UTSW 2 29,993,555 (GRCm39) missense probably benign 0.01
R0390:Zer1 UTSW 2 29,998,225 (GRCm39) splice site probably benign
R0506:Zer1 UTSW 2 29,991,819 (GRCm39) missense probably damaging 1.00
R0606:Zer1 UTSW 2 29,994,809 (GRCm39) splice site probably benign
R0928:Zer1 UTSW 2 29,991,775 (GRCm39) critical splice donor site probably null
R1167:Zer1 UTSW 2 29,998,258 (GRCm39) missense probably benign 0.00
R1819:Zer1 UTSW 2 30,000,230 (GRCm39) missense probably benign 0.18
R2040:Zer1 UTSW 2 29,998,286 (GRCm39) missense probably damaging 1.00
R2041:Zer1 UTSW 2 29,998,286 (GRCm39) missense probably damaging 1.00
R2042:Zer1 UTSW 2 29,998,286 (GRCm39) missense probably damaging 1.00
R2092:Zer1 UTSW 2 29,998,286 (GRCm39) missense probably damaging 1.00
R2168:Zer1 UTSW 2 29,994,887 (GRCm39) missense probably damaging 1.00
R2243:Zer1 UTSW 2 29,991,139 (GRCm39) missense probably damaging 0.99
R2254:Zer1 UTSW 2 29,998,286 (GRCm39) missense probably damaging 1.00
R2255:Zer1 UTSW 2 29,998,286 (GRCm39) missense probably damaging 1.00
R2311:Zer1 UTSW 2 29,991,834 (GRCm39) missense probably damaging 0.99
R2993:Zer1 UTSW 2 29,991,909 (GRCm39) missense probably damaging 1.00
R3010:Zer1 UTSW 2 30,003,297 (GRCm39) missense probably benign 0.13
R3731:Zer1 UTSW 2 30,000,923 (GRCm39) missense probably benign 0.44
R4038:Zer1 UTSW 2 29,997,535 (GRCm39) missense probably damaging 1.00
R5241:Zer1 UTSW 2 29,994,982 (GRCm39) missense probably damaging 1.00
R5433:Zer1 UTSW 2 29,990,998 (GRCm39) intron probably benign
R5443:Zer1 UTSW 2 30,001,008 (GRCm39) missense probably damaging 1.00
R5524:Zer1 UTSW 2 29,994,866 (GRCm39) missense probably damaging 1.00
R5936:Zer1 UTSW 2 29,997,679 (GRCm39) missense probably damaging 0.97
R5999:Zer1 UTSW 2 29,995,009 (GRCm39) missense probably damaging 1.00
R6598:Zer1 UTSW 2 30,003,286 (GRCm39) missense probably damaging 1.00
R6965:Zer1 UTSW 2 29,991,059 (GRCm39) missense possibly damaging 0.87
R7030:Zer1 UTSW 2 30,001,033 (GRCm39) missense probably benign 0.00
R7190:Zer1 UTSW 2 29,993,444 (GRCm39) missense probably damaging 1.00
R7218:Zer1 UTSW 2 29,995,024 (GRCm39) missense probably damaging 1.00
R7252:Zer1 UTSW 2 29,991,904 (GRCm39) missense probably damaging 0.99
R7383:Zer1 UTSW 2 30,001,253 (GRCm39) missense probably damaging 1.00
R7417:Zer1 UTSW 2 29,992,834 (GRCm39) missense probably damaging 1.00
R7459:Zer1 UTSW 2 30,003,337 (GRCm39) missense probably damaging 1.00
R7466:Zer1 UTSW 2 29,991,496 (GRCm39) splice site probably null
R7477:Zer1 UTSW 2 29,997,988 (GRCm39) missense probably null 0.34
R7719:Zer1 UTSW 2 30,001,243 (GRCm39) missense probably damaging 1.00
R7813:Zer1 UTSW 2 30,000,385 (GRCm39) missense probably damaging 1.00
R7976:Zer1 UTSW 2 29,997,520 (GRCm39) missense probably damaging 0.99
R8239:Zer1 UTSW 2 29,991,147 (GRCm39) critical splice acceptor site probably null
R8350:Zer1 UTSW 2 29,991,862 (GRCm39) missense probably damaging 1.00
R8404:Zer1 UTSW 2 29,995,035 (GRCm39) critical splice acceptor site probably null
R8842:Zer1 UTSW 2 30,001,062 (GRCm39) missense possibly damaging 0.65
R8896:Zer1 UTSW 2 29,993,430 (GRCm39) missense probably damaging 0.99
R8906:Zer1 UTSW 2 30,001,035 (GRCm39) missense probably benign 0.31
R8929:Zer1 UTSW 2 30,000,881 (GRCm39) missense probably damaging 1.00
R9050:Zer1 UTSW 2 30,001,294 (GRCm39) missense probably damaging 1.00
R9066:Zer1 UTSW 2 30,000,686 (GRCm39) missense probably damaging 1.00
R9277:Zer1 UTSW 2 30,001,297 (GRCm39) missense probably benign 0.00
R9322:Zer1 UTSW 2 30,000,923 (GRCm39) missense probably benign 0.00
R9577:Zer1 UTSW 2 29,991,050 (GRCm39) missense probably damaging 1.00
R9733:Zer1 UTSW 2 29,997,643 (GRCm39) missense probably benign 0.00
X0026:Zer1 UTSW 2 29,994,907 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACTGGGCAAGAAGATGTC -3'
(R):5'- GCATGACCCAGTGTTATATGAGAAC -3'

Sequencing Primer
(F):5'- AGATGTCTGGATGCAGCCG -3'
(R):5'- CTCAGGCTGGTCTGGAATTCC -3'
Posted On 2019-10-07