Incidental Mutation 'R7463:Or8j3'
ID 578544
Institutional Source Beutler Lab
Gene Symbol Or8j3
Ensembl Gene ENSMUSG00000075198
Gene Name olfactory receptor family 8 subfamily J member 3
Synonyms Olfr28, MTPCR11, GA_x6K02T2Q125-47672825-47671878, Olfr1045, MOR185-2
MMRRC Submission 045537-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.138) question?
Stock # R7463 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 86028147-86029094 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86028182 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 305 (M305V)
Ref Sequence ENSEMBL: ENSMUSP00000148982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099904] [ENSMUST00000215763]
AlphaFold Q7TR80
Predicted Effect probably benign
Transcript: ENSMUST00000099904
AA Change: M305V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097488
Gene: ENSMUSG00000075198
AA Change: M305V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.2e-43 PFAM
Pfam:7tm_1 41 290 5.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215763
AA Change: M305V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,634,698 (GRCm39) V435E probably damaging Het
Acta2 G A 19: 34,229,931 (GRCm39) T8I probably benign Het
Adcy2 T C 13: 68,878,399 (GRCm39) D413G probably damaging Het
Adgrg6 T A 10: 14,310,140 (GRCm39) D727V possibly damaging Het
Aebp2 C T 6: 140,583,452 (GRCm39) Q309* probably null Het
Amy1 A T 3: 113,363,533 (GRCm39) C43* probably null Het
Bpifc T C 10: 85,815,198 (GRCm39) E256G probably benign Het
Bysl A T 17: 47,913,396 (GRCm39) S296T probably benign Het
Carmil3 C T 14: 55,739,853 (GRCm39) P980L probably damaging Het
Coch T A 12: 51,640,408 (GRCm39) M1K probably null Het
Cpt2 A T 4: 107,765,354 (GRCm39) F137I probably damaging Het
Crem T C 18: 3,295,094 (GRCm39) I112V probably benign Het
Cul9 A G 17: 46,831,402 (GRCm39) probably null Het
Cyp3a41a T A 5: 145,650,374 (GRCm39) I90F probably damaging Het
Cyp4f16 C T 17: 32,769,761 (GRCm39) A457V possibly damaging Het
Ddx6 A G 9: 44,540,026 (GRCm39) E318G probably damaging Het
Dip2b A G 15: 100,052,038 (GRCm39) E213G probably benign Het
Dlx5 T C 6: 6,878,316 (GRCm39) H238R probably damaging Het
Dnai2 A C 11: 114,645,232 (GRCm39) I556L probably benign Het
Dnmt1 C T 9: 20,823,521 (GRCm39) V1147M possibly damaging Het
Egf G T 3: 129,533,664 (GRCm39) Q59K probably benign Het
Ermp1 A T 19: 29,623,662 (GRCm39) Y109* probably null Het
Fer1l6 T A 15: 58,445,450 (GRCm39) Y573* probably null Het
Fmnl1 T C 11: 103,083,954 (GRCm39) L503P probably damaging Het
Gnptab T G 10: 88,267,251 (GRCm39) I447M probably damaging Het
Hgf G A 5: 16,783,448 (GRCm39) D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Igf2r T C 17: 12,929,532 (GRCm39) T958A probably benign Het
Kcnd2 T A 6: 21,216,497 (GRCm39) L67Q probably damaging Het
Kif5a A G 10: 127,079,593 (GRCm39) V248A probably damaging Het
Krt33b A G 11: 99,920,389 (GRCm39) I88T probably damaging Het
Lhx2 G A 2: 38,241,858 (GRCm39) E25K possibly damaging Het
Mex3d C T 10: 80,217,532 (GRCm39) G562R Het
Myom2 A T 8: 15,167,679 (GRCm39) Y1088F probably null Het
Ncapg T A 5: 45,851,434 (GRCm39) probably null Het
Nudc A C 4: 133,261,714 (GRCm39) V190G possibly damaging Het
Obscn G T 11: 59,013,686 (GRCm39) R1054S probably benign Het
Or10g1 A G 14: 52,648,168 (GRCm39) W54R probably benign Het
Or10g9 A G 9: 39,911,860 (GRCm39) V221A probably benign Het
Or2d4 A T 7: 106,543,380 (GRCm39) V276E probably damaging Het
Or52h9 T C 7: 104,202,689 (GRCm39) S188P possibly damaging Het
Or56a5 T A 7: 104,793,144 (GRCm39) M119L probably benign Het
Pcdh10 A T 3: 45,338,007 (GRCm39) R891S possibly damaging Het
Pcdh15 C T 10: 74,467,602 (GRCm39) S1873L possibly damaging Het
Pcdh7 A G 5: 57,878,340 (GRCm39) K632E probably benign Het
Pcdhgb8 G A 18: 37,896,480 (GRCm39) A517T probably damaging Het
Ptgr2 A T 12: 84,339,072 (GRCm39) probably benign Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Racgap1 T A 15: 99,540,839 (GRCm39) T4S probably benign Het
Rb1cc1 A G 1: 6,319,404 (GRCm39) H941R probably benign Het
Reln T C 5: 22,308,433 (GRCm39) H312R probably damaging Het
Rnf166 T A 8: 123,194,726 (GRCm39) H208L probably damaging Het
Spmap2 T C 10: 79,412,549 (GRCm39) E314G probably damaging Het
Timeless T C 10: 128,086,295 (GRCm39) S999P probably benign Het
Tmem94 G T 11: 115,677,082 (GRCm39) R118L possibly damaging Het
Tor1aip1 A T 1: 155,883,355 (GRCm39) H349Q possibly damaging Het
Ttn T A 2: 76,750,804 (GRCm39) E3415V probably benign Het
Vmn2r102 A T 17: 19,896,886 (GRCm39) N78Y probably damaging Het
Wdr11 A T 7: 129,208,810 (GRCm39) D427V probably damaging Het
Zer1 A T 2: 30,003,449 (GRCm39) probably benign Het
Zfp516 T A 18: 82,975,233 (GRCm39) M477K probably benign Het
Other mutations in Or8j3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Or8j3 APN 2 86,028,149 (GRCm39) makesense probably null
IGL01914:Or8j3 APN 2 86,029,016 (GRCm39) missense probably benign 0.45
IGL01991:Or8j3 APN 2 86,028,877 (GRCm39) missense probably benign 0.23
IGL02623:Or8j3 APN 2 86,028,363 (GRCm39) missense probably damaging 1.00
R0325:Or8j3 UTSW 2 86,029,055 (GRCm39) missense possibly damaging 0.51
R0730:Or8j3 UTSW 2 86,029,069 (GRCm39) missense probably benign 0.14
R1457:Or8j3 UTSW 2 86,028,596 (GRCm39) missense probably damaging 0.99
R2037:Or8j3 UTSW 2 86,028,176 (GRCm39) missense probably benign
R2121:Or8j3 UTSW 2 86,028,340 (GRCm39) missense possibly damaging 0.88
R2271:Or8j3 UTSW 2 86,028,161 (GRCm39) missense probably benign 0.00
R3836:Or8j3 UTSW 2 86,029,006 (GRCm39) missense probably benign 0.02
R4669:Or8j3 UTSW 2 86,028,277 (GRCm39) missense possibly damaging 0.90
R6082:Or8j3 UTSW 2 86,028,661 (GRCm39) missense probably damaging 0.97
R7326:Or8j3 UTSW 2 86,028,917 (GRCm39) missense probably damaging 1.00
R7523:Or8j3 UTSW 2 86,028,389 (GRCm39) missense probably damaging 0.99
R7842:Or8j3 UTSW 2 86,028,516 (GRCm39) nonsense probably null
R7919:Or8j3 UTSW 2 86,028,609 (GRCm39) nonsense probably null
R9763:Or8j3 UTSW 2 86,028,181 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TCACAAGATGACATGGGCAATG -3'
(R):5'- CACAGTTTTCTATGGGACGCTG -3'

Sequencing Primer
(F):5'- CCCAGTGTAGGATTGACTTATCAG -3'
(R):5'- ACGCTGTTGTTTATGTATTTGCAACC -3'
Posted On 2019-10-07