Incidental Mutation 'R7463:Amy1'
ID 578546
Institutional Source Beutler Lab
Gene Symbol Amy1
Ensembl Gene ENSMUSG00000074264
Gene Name amylase 1, salivary
Synonyms Amy-1
MMRRC Submission 045537-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R7463 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 113349601-113371399 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 113363533 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 43 (C43*)
Ref Sequence ENSEMBL: ENSMUSP00000070368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067980] [ENSMUST00000106540] [ENSMUST00000142505] [ENSMUST00000174147]
AlphaFold P00687
Predicted Effect probably null
Transcript: ENSMUST00000067980
AA Change: C43*
SMART Domains Protein: ENSMUSP00000070368
Gene: ENSMUSG00000074264
AA Change: C43*

DomainStartEndE-ValueType
Aamy 26 413 6.31e-97 SMART
Aamy_C 422 510 4.02e-49 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106540
AA Change: C43*
SMART Domains Protein: ENSMUSP00000102150
Gene: ENSMUSG00000074264
AA Change: C43*

DomainStartEndE-ValueType
Aamy 26 413 6.31e-97 SMART
Aamy_C 422 510 4.02e-49 SMART
Predicted Effect probably null
Transcript: ENSMUST00000142505
AA Change: C43*
SMART Domains Protein: ENSMUSP00000120493
Gene: ENSMUSG00000074264
AA Change: C43*

DomainStartEndE-ValueType
Pfam:Alpha-amylase 36 271 1.4e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174147
AA Change: C43*
SMART Domains Protein: ENSMUSP00000133875
Gene: ENSMUSG00000074264
AA Change: C43*

DomainStartEndE-ValueType
Pfam:Alpha-amylase 35 129 2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-amylase family of proteins. Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, catalyzing the first step in digestion of dietary starch and glycogen. This gene and several family members are present in a gene cluster on chromosome 1. This gene encodes an amylase isoenzyme produced by the pancreas. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,634,698 (GRCm39) V435E probably damaging Het
Acta2 G A 19: 34,229,931 (GRCm39) T8I probably benign Het
Adcy2 T C 13: 68,878,399 (GRCm39) D413G probably damaging Het
Adgrg6 T A 10: 14,310,140 (GRCm39) D727V possibly damaging Het
Aebp2 C T 6: 140,583,452 (GRCm39) Q309* probably null Het
Bpifc T C 10: 85,815,198 (GRCm39) E256G probably benign Het
Bysl A T 17: 47,913,396 (GRCm39) S296T probably benign Het
Carmil3 C T 14: 55,739,853 (GRCm39) P980L probably damaging Het
Coch T A 12: 51,640,408 (GRCm39) M1K probably null Het
Cpt2 A T 4: 107,765,354 (GRCm39) F137I probably damaging Het
Crem T C 18: 3,295,094 (GRCm39) I112V probably benign Het
Cul9 A G 17: 46,831,402 (GRCm39) probably null Het
Cyp3a41a T A 5: 145,650,374 (GRCm39) I90F probably damaging Het
Cyp4f16 C T 17: 32,769,761 (GRCm39) A457V possibly damaging Het
Ddx6 A G 9: 44,540,026 (GRCm39) E318G probably damaging Het
Dip2b A G 15: 100,052,038 (GRCm39) E213G probably benign Het
Dlx5 T C 6: 6,878,316 (GRCm39) H238R probably damaging Het
Dnai2 A C 11: 114,645,232 (GRCm39) I556L probably benign Het
Dnmt1 C T 9: 20,823,521 (GRCm39) V1147M possibly damaging Het
Egf G T 3: 129,533,664 (GRCm39) Q59K probably benign Het
Ermp1 A T 19: 29,623,662 (GRCm39) Y109* probably null Het
Fer1l6 T A 15: 58,445,450 (GRCm39) Y573* probably null Het
Fmnl1 T C 11: 103,083,954 (GRCm39) L503P probably damaging Het
Gnptab T G 10: 88,267,251 (GRCm39) I447M probably damaging Het
Hgf G A 5: 16,783,448 (GRCm39) D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Igf2r T C 17: 12,929,532 (GRCm39) T958A probably benign Het
Kcnd2 T A 6: 21,216,497 (GRCm39) L67Q probably damaging Het
Kif5a A G 10: 127,079,593 (GRCm39) V248A probably damaging Het
Krt33b A G 11: 99,920,389 (GRCm39) I88T probably damaging Het
Lhx2 G A 2: 38,241,858 (GRCm39) E25K possibly damaging Het
Mex3d C T 10: 80,217,532 (GRCm39) G562R Het
Myom2 A T 8: 15,167,679 (GRCm39) Y1088F probably null Het
Ncapg T A 5: 45,851,434 (GRCm39) probably null Het
Nudc A C 4: 133,261,714 (GRCm39) V190G possibly damaging Het
Obscn G T 11: 59,013,686 (GRCm39) R1054S probably benign Het
Or10g1 A G 14: 52,648,168 (GRCm39) W54R probably benign Het
Or10g9 A G 9: 39,911,860 (GRCm39) V221A probably benign Het
Or2d4 A T 7: 106,543,380 (GRCm39) V276E probably damaging Het
Or52h9 T C 7: 104,202,689 (GRCm39) S188P possibly damaging Het
Or56a5 T A 7: 104,793,144 (GRCm39) M119L probably benign Het
Or8j3 T C 2: 86,028,182 (GRCm39) M305V probably benign Het
Pcdh10 A T 3: 45,338,007 (GRCm39) R891S possibly damaging Het
Pcdh15 C T 10: 74,467,602 (GRCm39) S1873L possibly damaging Het
Pcdh7 A G 5: 57,878,340 (GRCm39) K632E probably benign Het
Pcdhgb8 G A 18: 37,896,480 (GRCm39) A517T probably damaging Het
Ptgr2 A T 12: 84,339,072 (GRCm39) probably benign Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Racgap1 T A 15: 99,540,839 (GRCm39) T4S probably benign Het
Rb1cc1 A G 1: 6,319,404 (GRCm39) H941R probably benign Het
Reln T C 5: 22,308,433 (GRCm39) H312R probably damaging Het
Rnf166 T A 8: 123,194,726 (GRCm39) H208L probably damaging Het
Spmap2 T C 10: 79,412,549 (GRCm39) E314G probably damaging Het
Timeless T C 10: 128,086,295 (GRCm39) S999P probably benign Het
Tmem94 G T 11: 115,677,082 (GRCm39) R118L possibly damaging Het
Tor1aip1 A T 1: 155,883,355 (GRCm39) H349Q possibly damaging Het
Ttn T A 2: 76,750,804 (GRCm39) E3415V probably benign Het
Vmn2r102 A T 17: 19,896,886 (GRCm39) N78Y probably damaging Het
Wdr11 A T 7: 129,208,810 (GRCm39) D427V probably damaging Het
Zer1 A T 2: 30,003,449 (GRCm39) probably benign Het
Zfp516 T A 18: 82,975,233 (GRCm39) M477K probably benign Het
Other mutations in Amy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Amy1 APN 3 113,349,781 (GRCm39) missense probably damaging 1.00
IGL00966:Amy1 APN 3 113,349,689 (GRCm39) missense probably benign 0.00
IGL01153:Amy1 APN 3 113,349,724 (GRCm39) missense possibly damaging 0.69
IGL02415:Amy1 APN 3 113,357,234 (GRCm39) missense probably benign 0.27
IGL02555:Amy1 APN 3 113,358,541 (GRCm39) missense probably benign 0.01
IGL02572:Amy1 APN 3 113,358,722 (GRCm39) splice site probably benign
IGL03215:Amy1 APN 3 113,349,649 (GRCm39) missense probably benign
R0196:Amy1 UTSW 3 113,363,070 (GRCm39) missense probably benign
R0230:Amy1 UTSW 3 113,352,079 (GRCm39) missense probably benign 0.02
R0586:Amy1 UTSW 3 113,356,418 (GRCm39) unclassified probably benign
R1789:Amy1 UTSW 3 113,351,814 (GRCm39) missense possibly damaging 0.56
R1823:Amy1 UTSW 3 113,356,376 (GRCm39) missense probably null
R1922:Amy1 UTSW 3 113,358,544 (GRCm39) missense probably damaging 0.97
R2080:Amy1 UTSW 3 113,351,743 (GRCm39) missense probably benign 0.01
R3147:Amy1 UTSW 3 113,363,697 (GRCm39) start gained probably benign
R3437:Amy1 UTSW 3 113,349,658 (GRCm39) missense probably damaging 1.00
R4961:Amy1 UTSW 3 113,355,498 (GRCm39) missense probably damaging 1.00
R4977:Amy1 UTSW 3 113,363,026 (GRCm39) splice site probably null
R5304:Amy1 UTSW 3 113,352,013 (GRCm39) missense probably damaging 1.00
R5500:Amy1 UTSW 3 113,356,371 (GRCm39) missense probably damaging 1.00
R5503:Amy1 UTSW 3 113,349,709 (GRCm39) missense probably benign 0.26
R5706:Amy1 UTSW 3 113,349,769 (GRCm39) missense probably damaging 0.99
R5866:Amy1 UTSW 3 113,355,569 (GRCm39) missense possibly damaging 0.93
R5956:Amy1 UTSW 3 113,357,311 (GRCm39) missense probably benign 0.04
R6110:Amy1 UTSW 3 113,355,549 (GRCm39) missense probably damaging 1.00
R6259:Amy1 UTSW 3 113,363,059 (GRCm39) missense possibly damaging 0.73
R6278:Amy1 UTSW 3 113,355,339 (GRCm39) missense probably damaging 1.00
R6429:Amy1 UTSW 3 113,363,158 (GRCm39) missense probably damaging 1.00
R6893:Amy1 UTSW 3 113,357,281 (GRCm39) missense probably benign 0.00
R7136:Amy1 UTSW 3 113,357,248 (GRCm39) missense probably damaging 1.00
R9193:Amy1 UTSW 3 113,356,278 (GRCm39) missense probably benign 0.22
Z1177:Amy1 UTSW 3 113,352,002 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAAAGTTGCCATCCCAGCC -3'
(R):5'- ACAGAGCATTTATATAGTTTCCCTGGG -3'

Sequencing Primer
(F):5'- GTTGCCATCCCAGCCACTTTTC -3'
(R):5'- CATTGTTATTGGTAATTGCTTATGGC -3'
Posted On 2019-10-07