Incidental Mutation 'R7463:Egf'
ID578547
Institutional Source Beutler Lab
Gene Symbol Egf
Ensembl Gene ENSMUSG00000028017
Gene Nameepidermal growth factor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7463 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location129677565-129755316 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 129740015 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 59 (Q59K)
Ref Sequence ENSEMBL: ENSMUSP00000029653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029653]
PDB Structure
ROLE OF THE 6-20 DISULFIDE BRIDGE IN THE STRUCTURE AND ACTIVITY OF EPIDERMAL GROWTH FACTOR, NMR, 20 STRUCTURES [SOLUTION NMR]
SOLUTION STRUCTURE OF MURINE EPIDERMAL GROWTH FACTOR DETERMINED BY NMR SPECTROSCOPY AND REFINED BY ENERGY MINIMIZATION WITH RESTRAINTS [SOLUTION NMR]
THREE-DIMENSIONAL NUCLEAR MAGNETIC RESONANCE STRUCTURES OF MOUSE EPIDERMAL GROWTH FACTOR IN ACIDIC AND PHYSIOLOGICAL PH SOLUTIONS [SOLUTION NMR]
THREE-DIMENSIONAL NUCLEAR MAGNETIC RESONANCE STRUCTURES OF MOUSE EPIDERMAL GROWTH FACTOR IN ACIDIC AND PHYSIOLOGICAL PH SOLUTIONS [SOLUTION NMR]
THREE-DIMENSIONAL NUCLEAR MAGNETIC RESONANCE STRUCTURES OF MOUSE EPIDERMAL GROWTH FACTOR IN ACIDIC AND PHYSIOLOGICAL PH SOLUTIONS [SOLUTION NMR]
THREE-DIMENSIONAL NUCLEAR MAGNETIC RESONANCE STRUCTURES OF MOUSE EPIDERMAL GROWTH FACTOR IN ACIDIC AND PHYSIOLOGICAL PH SOLUTIONS [SOLUTION NMR]
SOLUTION STRUCTURE THE MEGF/TGFALPHA44-50 CHIMERIC GROWTH FACTOR [SOLUTION NMR]
SOLUTION STRUCTURE OF MURINE EPIDERMAL GROWTH FACTOR DETERMINED BY NMR SPECTROSCOPY AND REFINED BY ENERGY MINIMIZATION WITH RESTRAINTS [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000029653
AA Change: Q59K

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029653
Gene: ENSMUSG00000028017
AA Change: Q59K

DomainStartEndE-ValueType
low complexity region 10 19 N/A INTRINSIC
LY 74 115 1.81e-3 SMART
LY 116 157 4.16e-3 SMART
LY 158 199 6.86e-4 SMART
LY 200 244 1.06e-4 SMART
EGF_like 330 361 7.86e-1 SMART
EGF_CA 362 402 2.4e-8 SMART
EGF 406 443 8.65e-1 SMART
EGF 444 483 5.79e-2 SMART
LY 510 552 1.1e-7 SMART
LY 553 595 4.32e-10 SMART
LY 596 639 6.05e-14 SMART
LY 640 682 2.89e-11 SMART
LY 683 724 1.3e-4 SMART
EGF 750 787 6.21e-2 SMART
EGF 841 876 9.13e0 SMART
EGF_CA 877 918 5.92e-8 SMART
EGF_like 919 959 3.56e-4 SMART
EGF 981 1019 2.79e-4 SMART
transmembrane domain 1039 1061 N/A INTRINSIC
low complexity region 1080 1099 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes epidermal growth factor (EGF), the founding member of the EGF family of growth factors that are implicated in cell proliferation and differentiation. The encoded protein can localize to the membrane and function in juxtacrine signaling or undergo proteolytic processing to generate a soluble form of the hormone. Mice lacking the encoded protein do not exhibit an abnormal phenotype but transgenic mice overexpressing the encoded protein exhibit hypospermatogenesis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Null mutants have normal phenotype. Females triply null, for this locus and the amphiregulin and transforming growth factor alpha genes, are unable to nurse due to impaired mammary gland development and show mild integument and digestive system anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,772 V435E probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy2 T C 13: 68,730,280 D413G probably damaging Het
Adgrg6 T A 10: 14,434,396 D727V possibly damaging Het
Aebp2 C T 6: 140,637,726 Q309* probably null Het
Amy1 A T 3: 113,569,884 C43* probably null Het
Bpifc T C 10: 85,979,334 E256G probably benign Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Carmil3 C T 14: 55,502,396 P980L probably damaging Het
Coch T A 12: 51,593,625 M1K probably null Het
Cpt2 A T 4: 107,908,157 F137I probably damaging Het
Crem T C 18: 3,295,094 I112V probably benign Het
Cul9 A G 17: 46,520,476 probably null Het
Cyp3a41a T A 5: 145,713,564 I90F probably damaging Het
Cyp4f16 C T 17: 32,550,787 A457V possibly damaging Het
Ddx6 A G 9: 44,628,729 E318G probably damaging Het
Dip2b A G 15: 100,154,157 E213G probably benign Het
Dlx5 T C 6: 6,878,316 H238R probably damaging Het
Dnaic2 A C 11: 114,754,406 I556L probably benign Het
Dnmt1 C T 9: 20,912,225 V1147M possibly damaging Het
Ermp1 A T 19: 29,646,262 Y109* probably null Het
Fer1l6 T A 15: 58,573,601 Y573* probably null Het
Fmnl1 T C 11: 103,193,128 L503P probably damaging Het
Gnptab T G 10: 88,431,389 I447M probably damaging Het
Hgf G A 5: 16,578,450 D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Igf2r T C 17: 12,710,645 T958A probably benign Het
Kcnd2 T A 6: 21,216,498 L67Q probably damaging Het
Kif5a A G 10: 127,243,724 V248A probably damaging Het
Krt33b A G 11: 100,029,563 I88T probably damaging Het
Lhx2 G A 2: 38,351,846 E25K possibly damaging Het
Mex3d C T 10: 80,381,698 G562R Het
Myom2 A T 8: 15,117,679 Y1088F probably null Het
Ncapg T A 5: 45,694,092 probably null Het
Nudc A C 4: 133,534,403 V190G possibly damaging Het
Obscn G T 11: 59,122,860 R1054S probably benign Het
Olfr1045 T C 2: 86,197,838 M305V probably benign Het
Olfr1510 A G 14: 52,410,711 W54R probably benign Het
Olfr651 T C 7: 104,553,482 S188P possibly damaging Het
Olfr683 T A 7: 105,143,937 M119L probably benign Het
Olfr710 A T 7: 106,944,173 V276E probably damaging Het
Olfr979 A G 9: 40,000,564 V221A probably benign Het
Pcdh10 A T 3: 45,383,572 R891S possibly damaging Het
Pcdh15 C T 10: 74,631,770 S1873L possibly damaging Het
Pcdh7 A G 5: 57,720,998 K632E probably benign Het
Pcdhgb8 G A 18: 37,763,427 A517T probably damaging Het
Ptgr2 A T 12: 84,292,298 probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Racgap1 T A 15: 99,642,958 T4S probably benign Het
Rb1cc1 A G 1: 6,249,180 H941R probably benign Het
Reln T C 5: 22,103,435 H312R probably damaging Het
Rnf166 T A 8: 122,467,987 H208L probably damaging Het
Theg T C 10: 79,576,715 E314G probably damaging Het
Timeless T C 10: 128,250,426 S999P probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tor1aip1 A T 1: 156,007,609 H349Q possibly damaging Het
Ttn T A 2: 76,920,460 E3415V probably benign Het
Vmn2r102 A T 17: 19,676,624 N78Y probably damaging Het
Wdr11 A T 7: 129,607,086 D427V probably damaging Het
Zer1 A T 2: 30,113,437 probably benign Het
Zfp516 T A 18: 82,957,108 M477K probably benign Het
Other mutations in Egf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Egf APN 3 129711449 missense probably benign 0.01
IGL00579:Egf APN 3 129697798 missense probably benign 0.36
IGL01307:Egf APN 3 129739993 missense probably damaging 0.99
IGL01314:Egf APN 3 129686260 missense probably benign 0.16
IGL01360:Egf APN 3 129740020 missense probably damaging 1.00
IGL01367:Egf APN 3 129702455 critical splice donor site probably null
IGL01610:Egf APN 3 129706260 splice site probably benign
IGL01721:Egf APN 3 129697722 nonsense probably null
IGL01803:Egf APN 3 129736766 missense probably benign 0.09
IGL01866:Egf APN 3 129735880 missense probably benign 0.03
IGL02001:Egf APN 3 129716768 missense probably damaging 1.00
IGL02141:Egf APN 3 129739982 nonsense probably null
IGL02209:Egf APN 3 129707307 missense possibly damaging 0.93
IGL02347:Egf APN 3 129678377 missense probably benign 0.17
IGL02821:Egf APN 3 129702479 missense probably damaging 1.00
IGL02902:Egf APN 3 129681147 missense probably benign 0.34
IGL03114:Egf APN 3 129736880 missense probably damaging 0.98
PIT4151001:Egf UTSW 3 129702549 missense probably benign 0.00
R0200:Egf UTSW 3 129706233 missense probably benign 0.00
R0200:Egf UTSW 3 129737549 missense probably damaging 1.00
R0463:Egf UTSW 3 129706233 missense probably benign 0.00
R0463:Egf UTSW 3 129737549 missense probably damaging 1.00
R0507:Egf UTSW 3 129681179 missense possibly damaging 0.62
R0801:Egf UTSW 3 129702585 splice site probably benign
R1495:Egf UTSW 3 129713006 missense probably damaging 1.00
R1535:Egf UTSW 3 129690778 missense probably benign 0.00
R1626:Egf UTSW 3 129686215 missense possibly damaging 0.55
R1702:Egf UTSW 3 129690811 missense probably benign 0.17
R1906:Egf UTSW 3 129725224 missense probably benign 0.01
R2184:Egf UTSW 3 129723358 nonsense probably null
R3842:Egf UTSW 3 129697793 nonsense probably null
R3918:Egf UTSW 3 129696860 missense probably null 0.22
R4073:Egf UTSW 3 129735969 missense probably benign 0.01
R4074:Egf UTSW 3 129735969 missense probably benign 0.01
R4075:Egf UTSW 3 129735969 missense probably benign 0.01
R4307:Egf UTSW 3 129719095 missense probably damaging 0.99
R4321:Egf UTSW 3 129706134 missense probably damaging 1.00
R4617:Egf UTSW 3 129690793 missense probably benign 0.02
R4646:Egf UTSW 3 129720276 missense probably damaging 1.00
R4674:Egf UTSW 3 129718040 missense probably damaging 1.00
R4798:Egf UTSW 3 129716678 missense probably damaging 1.00
R4931:Egf UTSW 3 129711468 missense probably damaging 1.00
R4992:Egf UTSW 3 129711530 intron probably null
R5166:Egf UTSW 3 129735840 missense probably benign
R5179:Egf UTSW 3 129686287 missense probably damaging 0.99
R5230:Egf UTSW 3 129718024 missense possibly damaging 0.95
R6043:Egf UTSW 3 129736785 missense probably benign 0.09
R6119:Egf UTSW 3 129736772 missense probably benign 0.00
R6493:Egf UTSW 3 129719088 start gained probably benign
R6639:Egf UTSW 3 129736832 missense probably benign 0.22
R6936:Egf UTSW 3 129681204 missense possibly damaging 0.95
R7019:Egf UTSW 3 129718064 splice site probably null
R7046:Egf UTSW 3 129754958 missense unknown
R7472:Egf UTSW 3 129686263 missense possibly damaging 0.53
R7723:Egf UTSW 3 129706137 missense probably benign 0.00
R7920:Egf UTSW 3 129735840 missense probably benign
R7952:Egf UTSW 3 129739996 missense probably damaging 1.00
R8098:Egf UTSW 3 129690837 missense probably benign 0.09
R8344:Egf UTSW 3 129754943 missense unknown
X0011:Egf UTSW 3 129711298 missense probably benign 0.19
Z1176:Egf UTSW 3 129697717 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTACGCCACATTTGTCAGAATTTG -3'
(R):5'- GGCAGGAGTCCCTTATTCTG -3'

Sequencing Primer
(F):5'- ATTCTTCACATACCATGGGGG -3'
(R):5'- GCAGGAGTCCCTTATTCTGTACAG -3'
Posted On2019-10-07