Incidental Mutation 'R7463:Egf'
ID 578547
Institutional Source Beutler Lab
Gene Symbol Egf
Ensembl Gene ENSMUSG00000028017
Gene Name epidermal growth factor
Synonyms
MMRRC Submission 045537-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7463 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 129471223-129548971 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 129533664 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 59 (Q59K)
Ref Sequence ENSEMBL: ENSMUSP00000029653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029653]
AlphaFold P01132
PDB Structure ROLE OF THE 6-20 DISULFIDE BRIDGE IN THE STRUCTURE AND ACTIVITY OF EPIDERMAL GROWTH FACTOR, NMR, 20 STRUCTURES [SOLUTION NMR]
SOLUTION STRUCTURE OF MURINE EPIDERMAL GROWTH FACTOR DETERMINED BY NMR SPECTROSCOPY AND REFINED BY ENERGY MINIMIZATION WITH RESTRAINTS [SOLUTION NMR]
THREE-DIMENSIONAL NUCLEAR MAGNETIC RESONANCE STRUCTURES OF MOUSE EPIDERMAL GROWTH FACTOR IN ACIDIC AND PHYSIOLOGICAL PH SOLUTIONS [SOLUTION NMR]
THREE-DIMENSIONAL NUCLEAR MAGNETIC RESONANCE STRUCTURES OF MOUSE EPIDERMAL GROWTH FACTOR IN ACIDIC AND PHYSIOLOGICAL PH SOLUTIONS [SOLUTION NMR]
THREE-DIMENSIONAL NUCLEAR MAGNETIC RESONANCE STRUCTURES OF MOUSE EPIDERMAL GROWTH FACTOR IN ACIDIC AND PHYSIOLOGICAL PH SOLUTIONS [SOLUTION NMR]
THREE-DIMENSIONAL NUCLEAR MAGNETIC RESONANCE STRUCTURES OF MOUSE EPIDERMAL GROWTH FACTOR IN ACIDIC AND PHYSIOLOGICAL PH SOLUTIONS [SOLUTION NMR]
SOLUTION STRUCTURE THE MEGF/TGFALPHA44-50 CHIMERIC GROWTH FACTOR [SOLUTION NMR]
SOLUTION STRUCTURE OF MURINE EPIDERMAL GROWTH FACTOR DETERMINED BY NMR SPECTROSCOPY AND REFINED BY ENERGY MINIMIZATION WITH RESTRAINTS [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000029653
AA Change: Q59K

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029653
Gene: ENSMUSG00000028017
AA Change: Q59K

DomainStartEndE-ValueType
low complexity region 10 19 N/A INTRINSIC
LY 74 115 1.81e-3 SMART
LY 116 157 4.16e-3 SMART
LY 158 199 6.86e-4 SMART
LY 200 244 1.06e-4 SMART
EGF_like 330 361 7.86e-1 SMART
EGF_CA 362 402 2.4e-8 SMART
EGF 406 443 8.65e-1 SMART
EGF 444 483 5.79e-2 SMART
LY 510 552 1.1e-7 SMART
LY 553 595 4.32e-10 SMART
LY 596 639 6.05e-14 SMART
LY 640 682 2.89e-11 SMART
LY 683 724 1.3e-4 SMART
EGF 750 787 6.21e-2 SMART
EGF 841 876 9.13e0 SMART
EGF_CA 877 918 5.92e-8 SMART
EGF_like 919 959 3.56e-4 SMART
EGF 981 1019 2.79e-4 SMART
transmembrane domain 1039 1061 N/A INTRINSIC
low complexity region 1080 1099 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes epidermal growth factor (EGF), the founding member of the EGF family of growth factors that are implicated in cell proliferation and differentiation. The encoded protein can localize to the membrane and function in juxtacrine signaling or undergo proteolytic processing to generate a soluble form of the hormone. Mice lacking the encoded protein do not exhibit an abnormal phenotype but transgenic mice overexpressing the encoded protein exhibit hypospermatogenesis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Null mutants have normal phenotype. Females triply null, for this locus and the amphiregulin and transforming growth factor alpha genes, are unable to nurse due to impaired mammary gland development and show mild integument and digestive system anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,634,698 (GRCm39) V435E probably damaging Het
Acta2 G A 19: 34,229,931 (GRCm39) T8I probably benign Het
Adcy2 T C 13: 68,878,399 (GRCm39) D413G probably damaging Het
Adgrg6 T A 10: 14,310,140 (GRCm39) D727V possibly damaging Het
Aebp2 C T 6: 140,583,452 (GRCm39) Q309* probably null Het
Amy1 A T 3: 113,363,533 (GRCm39) C43* probably null Het
Bpifc T C 10: 85,815,198 (GRCm39) E256G probably benign Het
Bysl A T 17: 47,913,396 (GRCm39) S296T probably benign Het
Carmil3 C T 14: 55,739,853 (GRCm39) P980L probably damaging Het
Coch T A 12: 51,640,408 (GRCm39) M1K probably null Het
Cpt2 A T 4: 107,765,354 (GRCm39) F137I probably damaging Het
Crem T C 18: 3,295,094 (GRCm39) I112V probably benign Het
Cul9 A G 17: 46,831,402 (GRCm39) probably null Het
Cyp3a41a T A 5: 145,650,374 (GRCm39) I90F probably damaging Het
Cyp4f16 C T 17: 32,769,761 (GRCm39) A457V possibly damaging Het
Ddx6 A G 9: 44,540,026 (GRCm39) E318G probably damaging Het
Dip2b A G 15: 100,052,038 (GRCm39) E213G probably benign Het
Dlx5 T C 6: 6,878,316 (GRCm39) H238R probably damaging Het
Dnai2 A C 11: 114,645,232 (GRCm39) I556L probably benign Het
Dnmt1 C T 9: 20,823,521 (GRCm39) V1147M possibly damaging Het
Ermp1 A T 19: 29,623,662 (GRCm39) Y109* probably null Het
Fer1l6 T A 15: 58,445,450 (GRCm39) Y573* probably null Het
Fmnl1 T C 11: 103,083,954 (GRCm39) L503P probably damaging Het
Gnptab T G 10: 88,267,251 (GRCm39) I447M probably damaging Het
Hgf G A 5: 16,783,448 (GRCm39) D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Igf2r T C 17: 12,929,532 (GRCm39) T958A probably benign Het
Kcnd2 T A 6: 21,216,497 (GRCm39) L67Q probably damaging Het
Kif5a A G 10: 127,079,593 (GRCm39) V248A probably damaging Het
Krt33b A G 11: 99,920,389 (GRCm39) I88T probably damaging Het
Lhx2 G A 2: 38,241,858 (GRCm39) E25K possibly damaging Het
Mex3d C T 10: 80,217,532 (GRCm39) G562R Het
Myom2 A T 8: 15,167,679 (GRCm39) Y1088F probably null Het
Ncapg T A 5: 45,851,434 (GRCm39) probably null Het
Nudc A C 4: 133,261,714 (GRCm39) V190G possibly damaging Het
Obscn G T 11: 59,013,686 (GRCm39) R1054S probably benign Het
Or10g1 A G 14: 52,648,168 (GRCm39) W54R probably benign Het
Or10g9 A G 9: 39,911,860 (GRCm39) V221A probably benign Het
Or2d4 A T 7: 106,543,380 (GRCm39) V276E probably damaging Het
Or52h9 T C 7: 104,202,689 (GRCm39) S188P possibly damaging Het
Or56a5 T A 7: 104,793,144 (GRCm39) M119L probably benign Het
Or8j3 T C 2: 86,028,182 (GRCm39) M305V probably benign Het
Pcdh10 A T 3: 45,338,007 (GRCm39) R891S possibly damaging Het
Pcdh15 C T 10: 74,467,602 (GRCm39) S1873L possibly damaging Het
Pcdh7 A G 5: 57,878,340 (GRCm39) K632E probably benign Het
Pcdhgb8 G A 18: 37,896,480 (GRCm39) A517T probably damaging Het
Ptgr2 A T 12: 84,339,072 (GRCm39) probably benign Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Racgap1 T A 15: 99,540,839 (GRCm39) T4S probably benign Het
Rb1cc1 A G 1: 6,319,404 (GRCm39) H941R probably benign Het
Reln T C 5: 22,308,433 (GRCm39) H312R probably damaging Het
Rnf166 T A 8: 123,194,726 (GRCm39) H208L probably damaging Het
Spmap2 T C 10: 79,412,549 (GRCm39) E314G probably damaging Het
Timeless T C 10: 128,086,295 (GRCm39) S999P probably benign Het
Tmem94 G T 11: 115,677,082 (GRCm39) R118L possibly damaging Het
Tor1aip1 A T 1: 155,883,355 (GRCm39) H349Q possibly damaging Het
Ttn T A 2: 76,750,804 (GRCm39) E3415V probably benign Het
Vmn2r102 A T 17: 19,896,886 (GRCm39) N78Y probably damaging Het
Wdr11 A T 7: 129,208,810 (GRCm39) D427V probably damaging Het
Zer1 A T 2: 30,003,449 (GRCm39) probably benign Het
Zfp516 T A 18: 82,975,233 (GRCm39) M477K probably benign Het
Other mutations in Egf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Egf APN 3 129,505,098 (GRCm39) missense probably benign 0.01
IGL00579:Egf APN 3 129,491,447 (GRCm39) missense probably benign 0.36
IGL01307:Egf APN 3 129,533,642 (GRCm39) missense probably damaging 0.99
IGL01314:Egf APN 3 129,479,909 (GRCm39) missense probably benign 0.16
IGL01360:Egf APN 3 129,533,669 (GRCm39) missense probably damaging 1.00
IGL01367:Egf APN 3 129,496,104 (GRCm39) critical splice donor site probably null
IGL01610:Egf APN 3 129,499,909 (GRCm39) splice site probably benign
IGL01721:Egf APN 3 129,491,371 (GRCm39) nonsense probably null
IGL01803:Egf APN 3 129,530,415 (GRCm39) missense probably benign 0.09
IGL01866:Egf APN 3 129,529,529 (GRCm39) missense probably benign 0.03
IGL02001:Egf APN 3 129,510,417 (GRCm39) missense probably damaging 1.00
IGL02141:Egf APN 3 129,533,631 (GRCm39) nonsense probably null
IGL02209:Egf APN 3 129,500,956 (GRCm39) missense possibly damaging 0.93
IGL02347:Egf APN 3 129,472,026 (GRCm39) missense probably benign 0.17
IGL02821:Egf APN 3 129,496,128 (GRCm39) missense probably damaging 1.00
IGL02902:Egf APN 3 129,474,796 (GRCm39) missense probably benign 0.34
IGL03114:Egf APN 3 129,530,529 (GRCm39) missense probably damaging 0.98
PIT4151001:Egf UTSW 3 129,496,198 (GRCm39) missense probably benign 0.00
R0200:Egf UTSW 3 129,531,198 (GRCm39) missense probably damaging 1.00
R0200:Egf UTSW 3 129,499,882 (GRCm39) missense probably benign 0.00
R0463:Egf UTSW 3 129,531,198 (GRCm39) missense probably damaging 1.00
R0463:Egf UTSW 3 129,499,882 (GRCm39) missense probably benign 0.00
R0507:Egf UTSW 3 129,474,828 (GRCm39) missense possibly damaging 0.62
R0801:Egf UTSW 3 129,496,234 (GRCm39) splice site probably benign
R1495:Egf UTSW 3 129,506,655 (GRCm39) missense probably damaging 1.00
R1535:Egf UTSW 3 129,484,427 (GRCm39) missense probably benign 0.00
R1626:Egf UTSW 3 129,479,864 (GRCm39) missense possibly damaging 0.55
R1702:Egf UTSW 3 129,484,460 (GRCm39) missense probably benign 0.17
R1906:Egf UTSW 3 129,518,873 (GRCm39) missense probably benign 0.01
R2184:Egf UTSW 3 129,517,007 (GRCm39) nonsense probably null
R3842:Egf UTSW 3 129,491,442 (GRCm39) nonsense probably null
R3918:Egf UTSW 3 129,490,509 (GRCm39) missense probably null 0.22
R4073:Egf UTSW 3 129,529,618 (GRCm39) missense probably benign 0.01
R4074:Egf UTSW 3 129,529,618 (GRCm39) missense probably benign 0.01
R4075:Egf UTSW 3 129,529,618 (GRCm39) missense probably benign 0.01
R4307:Egf UTSW 3 129,512,744 (GRCm39) missense probably damaging 0.99
R4321:Egf UTSW 3 129,499,783 (GRCm39) missense probably damaging 1.00
R4617:Egf UTSW 3 129,484,442 (GRCm39) missense probably benign 0.02
R4646:Egf UTSW 3 129,513,925 (GRCm39) missense probably damaging 1.00
R4674:Egf UTSW 3 129,511,689 (GRCm39) missense probably damaging 1.00
R4798:Egf UTSW 3 129,510,327 (GRCm39) missense probably damaging 1.00
R4931:Egf UTSW 3 129,505,117 (GRCm39) missense probably damaging 1.00
R4992:Egf UTSW 3 129,505,179 (GRCm39) splice site probably null
R5166:Egf UTSW 3 129,529,489 (GRCm39) missense probably benign
R5179:Egf UTSW 3 129,479,936 (GRCm39) missense probably damaging 0.99
R5230:Egf UTSW 3 129,511,673 (GRCm39) missense possibly damaging 0.95
R6043:Egf UTSW 3 129,530,434 (GRCm39) missense probably benign 0.09
R6119:Egf UTSW 3 129,530,421 (GRCm39) missense probably benign 0.00
R6493:Egf UTSW 3 129,512,737 (GRCm39) start gained probably benign
R6639:Egf UTSW 3 129,530,481 (GRCm39) missense probably benign 0.22
R6936:Egf UTSW 3 129,474,853 (GRCm39) missense possibly damaging 0.95
R7019:Egf UTSW 3 129,511,713 (GRCm39) splice site probably null
R7046:Egf UTSW 3 129,548,607 (GRCm39) missense unknown
R7472:Egf UTSW 3 129,479,912 (GRCm39) missense possibly damaging 0.53
R7723:Egf UTSW 3 129,499,786 (GRCm39) missense probably benign 0.00
R7920:Egf UTSW 3 129,529,489 (GRCm39) missense probably benign
R7952:Egf UTSW 3 129,533,645 (GRCm39) missense probably damaging 1.00
R8098:Egf UTSW 3 129,484,486 (GRCm39) missense probably benign 0.09
R8344:Egf UTSW 3 129,548,592 (GRCm39) missense unknown
R8557:Egf UTSW 3 129,548,600 (GRCm39) missense unknown
R8912:Egf UTSW 3 129,531,164 (GRCm39) missense possibly damaging 0.47
R9091:Egf UTSW 3 129,529,449 (GRCm39) critical splice donor site probably null
R9159:Egf UTSW 3 129,472,026 (GRCm39) missense probably benign 0.17
R9270:Egf UTSW 3 129,529,449 (GRCm39) critical splice donor site probably null
R9526:Egf UTSW 3 129,491,421 (GRCm39) missense probably benign
R9544:Egf UTSW 3 129,511,617 (GRCm39) missense probably benign 0.16
R9588:Egf UTSW 3 129,511,617 (GRCm39) missense probably benign 0.16
R9630:Egf UTSW 3 129,518,844 (GRCm39) missense possibly damaging 0.76
R9639:Egf UTSW 3 129,513,949 (GRCm39) missense possibly damaging 0.93
R9751:Egf UTSW 3 129,548,538 (GRCm39) missense probably damaging 0.99
R9772:Egf UTSW 3 129,499,756 (GRCm39) missense probably benign 0.01
R9776:Egf UTSW 3 129,530,514 (GRCm39) missense probably damaging 0.99
X0011:Egf UTSW 3 129,504,947 (GRCm39) missense probably benign 0.19
Z1176:Egf UTSW 3 129,491,366 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTACGCCACATTTGTCAGAATTTG -3'
(R):5'- GGCAGGAGTCCCTTATTCTG -3'

Sequencing Primer
(F):5'- ATTCTTCACATACCATGGGGG -3'
(R):5'- GCAGGAGTCCCTTATTCTGTACAG -3'
Posted On 2019-10-07