Incidental Mutation 'R7463:Cpt2'
ID578548
Institutional Source Beutler Lab
Gene Symbol Cpt2
Ensembl Gene ENSMUSG00000028607
Gene Namecarnitine palmitoyltransferase 2
SynonymsCPT II, CPTII
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R7463 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location107903981-107923610 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107908157 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 137 (F137I)
Ref Sequence ENSEMBL: ENSMUSP00000030345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030345] [ENSMUST00000106719] [ENSMUST00000106720] [ENSMUST00000131644]
Predicted Effect probably damaging
Transcript: ENSMUST00000030345
AA Change: F137I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030345
Gene: ENSMUSG00000028607
AA Change: F137I

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 49 648 1.4e-190 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106719
SMART Domains Protein: ENSMUSP00000102330
Gene: ENSMUSG00000028607

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 48 265 1.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106720
SMART Domains Protein: ENSMUSP00000102331
Gene: ENSMUSG00000028607

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 48 113 2.1e-21 PFAM
Pfam:Carn_acyltransf 101 214 1.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131644
SMART Domains Protein: ENSMUSP00000114362
Gene: ENSMUSG00000028607

DomainStartEndE-ValueType
PDB:4EYW|B 27 88 2e-28 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear protein which is transported to the mitochondrial inner membrane. Together with carnitine palmitoyltransferase I, the encoded protein oxidizes long-chain fatty acids in the mitochondria. Defects in this gene are associated with mitochondrial long-chain fatty-acid (LCFA) oxidation disorders. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,772 V435E probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy2 T C 13: 68,730,280 D413G probably damaging Het
Adgrg6 T A 10: 14,434,396 D727V possibly damaging Het
Aebp2 C T 6: 140,637,726 Q309* probably null Het
Amy1 A T 3: 113,569,884 C43* probably null Het
Bpifc T C 10: 85,979,334 E256G probably benign Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Carmil3 C T 14: 55,502,396 P980L probably damaging Het
Coch T A 12: 51,593,625 M1K probably null Het
Crem T C 18: 3,295,094 I112V probably benign Het
Cul9 A G 17: 46,520,476 probably null Het
Cyp3a41a T A 5: 145,713,564 I90F probably damaging Het
Cyp4f16 C T 17: 32,550,787 A457V possibly damaging Het
Ddx6 A G 9: 44,628,729 E318G probably damaging Het
Dip2b A G 15: 100,154,157 E213G probably benign Het
Dlx5 T C 6: 6,878,316 H238R probably damaging Het
Dnaic2 A C 11: 114,754,406 I556L probably benign Het
Dnmt1 C T 9: 20,912,225 V1147M possibly damaging Het
Egf G T 3: 129,740,015 Q59K probably benign Het
Ermp1 A T 19: 29,646,262 Y109* probably null Het
Fer1l6 T A 15: 58,573,601 Y573* probably null Het
Fmnl1 T C 11: 103,193,128 L503P probably damaging Het
Gnptab T G 10: 88,431,389 I447M probably damaging Het
Hgf G A 5: 16,578,450 D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Igf2r T C 17: 12,710,645 T958A probably benign Het
Kcnd2 T A 6: 21,216,498 L67Q probably damaging Het
Kif5a A G 10: 127,243,724 V248A probably damaging Het
Krt33b A G 11: 100,029,563 I88T probably damaging Het
Lhx2 G A 2: 38,351,846 E25K possibly damaging Het
Mex3d C T 10: 80,381,698 G562R Het
Myom2 A T 8: 15,117,679 Y1088F probably null Het
Ncapg T A 5: 45,694,092 probably null Het
Nudc A C 4: 133,534,403 V190G possibly damaging Het
Obscn G T 11: 59,122,860 R1054S probably benign Het
Olfr1045 T C 2: 86,197,838 M305V probably benign Het
Olfr1510 A G 14: 52,410,711 W54R probably benign Het
Olfr651 T C 7: 104,553,482 S188P possibly damaging Het
Olfr683 T A 7: 105,143,937 M119L probably benign Het
Olfr710 A T 7: 106,944,173 V276E probably damaging Het
Olfr979 A G 9: 40,000,564 V221A probably benign Het
Pcdh10 A T 3: 45,383,572 R891S possibly damaging Het
Pcdh15 C T 10: 74,631,770 S1873L possibly damaging Het
Pcdh7 A G 5: 57,720,998 K632E probably benign Het
Pcdhgb8 G A 18: 37,763,427 A517T probably damaging Het
Ptgr2 A T 12: 84,292,298 probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Racgap1 T A 15: 99,642,958 T4S probably benign Het
Rb1cc1 A G 1: 6,249,180 H941R probably benign Het
Reln T C 5: 22,103,435 H312R probably damaging Het
Rnf166 T A 8: 122,467,987 H208L probably damaging Het
Theg T C 10: 79,576,715 E314G probably damaging Het
Timeless T C 10: 128,250,426 S999P probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tor1aip1 A T 1: 156,007,609 H349Q possibly damaging Het
Ttn T A 2: 76,920,460 E3415V probably benign Het
Vmn2r102 A T 17: 19,676,624 N78Y probably damaging Het
Wdr11 A T 7: 129,607,086 D427V probably damaging Het
Zer1 A T 2: 30,113,437 probably benign Het
Zfp516 T A 18: 82,957,108 M477K probably benign Het
Other mutations in Cpt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02655:Cpt2 APN 4 107907427 missense probably damaging 1.00
IGL02755:Cpt2 APN 4 107907775 missense probably damaging 1.00
IGL02803:Cpt2 APN 4 107907386 missense probably benign
IGL03066:Cpt2 APN 4 107907986 missense probably benign 0.01
IGL03180:Cpt2 APN 4 107906960 missense probably damaging 1.00
R0037:Cpt2 UTSW 4 107907974 missense probably damaging 0.99
R0046:Cpt2 UTSW 4 107904362 unclassified probably null
R0046:Cpt2 UTSW 4 107904362 unclassified probably null
R0598:Cpt2 UTSW 4 107906938 missense probably damaging 1.00
R1844:Cpt2 UTSW 4 107904255 missense possibly damaging 0.68
R2432:Cpt2 UTSW 4 107904526 nonsense probably null
R6326:Cpt2 UTSW 4 107914316 missense probably benign 0.00
R6682:Cpt2 UTSW 4 107904430 missense probably damaging 1.00
R6803:Cpt2 UTSW 4 107912664 missense probably damaging 1.00
R7491:Cpt2 UTSW 4 107907142 missense probably damaging 1.00
R7572:Cpt2 UTSW 4 107907548 missense probably damaging 1.00
R7645:Cpt2 UTSW 4 107906974 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGCATTGACCAGGTAGGCTC -3'
(R):5'- ACACTCGCCTTCTTGAAGTTG -3'

Sequencing Primer
(F):5'- TTGACCAGGTAGGCTCCATAC -3'
(R):5'- GAAGTTGGTATCATTTCTGCCAC -3'
Posted On2019-10-07