Mutagenetix > Incidental Mutations

Incidental Mutation 'R7463:Hgf'

578550

Institutional Source

Beutler Lab

Gene Symbol

Hgf

Ensembl Gene

ENSMUSG00000028864

Gene Name

hepatocyte growth factor

Synonyms

HGF/SF, NK1, C230052L06Rik, scatter factor, NK2, SF/HGF

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7463 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

16553495-16620152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 16578450 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 253 (D253N)

Ref Sequence

ENSEMBL: ENSMUSP00000030683 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030683] [ENSMUST00000196645] [ENSMUST00000199581]

PDB Structure

A Mechanistic Basis for Converting a Receptor Tyrosine Kinase Agonist to an Antagonist [X-RAY DIFFRACTION]
Crystal structure of the N-terminal fragment (31-127) of the mouse hepatocyte growth factor/scatter factor [X-RAY DIFFRACTION]
Crystal Structure of the NK2 Fragment (31-290) of the mouse Hepatocyte Growth Factor/Scatter Factor [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000030683
AA Change: D253N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000030683
Gene: ENSMUSG00000028864
AA Change: D253N

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
PAN_AP	38	123	6.47e-13	SMART
KR	127	209	3.03e-46	SMART
KR	210	291	9.04e-45	SMART
KR	304	386	7.35e-45	SMART
KR	390	472	1.02e-38	SMART
Tryp_SPc	495	719	5.6e-55	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000196645
AA Change: D248N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000142517
Gene: ENSMUSG00000028864
AA Change: D248N

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
PAN_AP	38	123	6.47e-13	SMART
KR	127	204	3.76e-42	SMART
KR	205	286	9.04e-45	SMART
KR	299	381	7.35e-45	SMART
KR	385	467	1.02e-38	SMART
Tryp_SPc	490	714	5.6e-55	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000199581
AA Change: D253N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000143424
Gene: ENSMUSG00000028864
AA Change: D253N

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
PAN_AP	38	123	6.47e-13	SMART
KR	127	209	3.03e-46	SMART
KR	210	291	9.04e-45	SMART
KR	304	386	7.35e-45	SMART
KR	390	472	1.02e-38	SMART
Tryp_SPc	495	719	5.6e-55	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.7%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the hepatocyte growth factor alpha and beta chains, which heterodimerize to form the mature active protein. Although this protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Homozygous knockout mice for this gene exhibit embryonic lethality due to impaired development of the placenta and liver. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced embryonic livers, impaired migration of dermomyotome precursors affecting skeletal muscle formation, defective navigation of hypoglossal motor axons, abnormal placentas, and prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	A	T	17: 46,323,772	V435E	probably damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adcy2	T	C	13: 68,730,280	D413G	probably damaging	Het
Adgrg6	T	A	10: 14,434,396	D727V	possibly damaging	Het
Aebp2	C	T	6: 140,637,726	Q309*	probably null	Het
Amy1	A	T	3: 113,569,884	C43*	probably null	Het
Bpifc	T	C	10: 85,979,334	E256G	probably benign	Het
Bysl	A	T	17: 47,602,471	S296T	probably benign	Het
Carmil3	C	T	14: 55,502,396	P980L	probably damaging	Het
Coch	T	A	12: 51,593,625	M1K	probably null	Het
Cpt2	A	T	4: 107,908,157	F137I	probably damaging	Het
Crem	T	C	18: 3,295,094	I112V	probably benign	Het
Cul9	A	G	17: 46,520,476		probably null	Het
Cyp3a41a	T	A	5: 145,713,564	I90F	probably damaging	Het
Cyp4f16	C	T	17: 32,550,787	A457V	possibly damaging	Het
Ddx6	A	G	9: 44,628,729	E318G	probably damaging	Het
Dip2b	A	G	15: 100,154,157	E213G	probably benign	Het
Dlx5	T	C	6: 6,878,316	H238R	probably damaging	Het
Dnaic2	A	C	11: 114,754,406	I556L	probably benign	Het
Dnmt1	C	T	9: 20,912,225	V1147M	possibly damaging	Het
Egf	G	T	3: 129,740,015	Q59K	probably benign	Het
Ermp1	A	T	19: 29,646,262	Y109*	probably null	Het
Fer1l6	T	A	15: 58,573,601	Y573*	probably null	Het
Fmnl1	T	C	11: 103,193,128	L503P	probably damaging	Het
Gnptab	T	G	10: 88,431,389	I447M	probably damaging	Het
Hjurp	CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT	C	1: 88,266,277		probably benign	Het
Igf2r	T	C	17: 12,710,645	T958A	probably benign	Het
Kcnd2	T	A	6: 21,216,498	L67Q	probably damaging	Het
Kif5a	A	G	10: 127,243,724	V248A	probably damaging	Het
Krt33b	A	G	11: 100,029,563	I88T	probably damaging	Het
Lhx2	G	A	2: 38,351,846	E25K	possibly damaging	Het
Mex3d	C	T	10: 80,381,698	G562R		Het
Myom2	A	T	8: 15,117,679	Y1088F	probably null	Het
Ncapg	T	A	5: 45,694,092		probably null	Het
Nudc	A	C	4: 133,534,403	V190G	possibly damaging	Het
Obscn	G	T	11: 59,122,860	R1054S	probably benign	Het
Olfr1045	T	C	2: 86,197,838	M305V	probably benign	Het
Olfr1510	A	G	14: 52,410,711	W54R	probably benign	Het
Olfr651	T	C	7: 104,553,482	S188P	possibly damaging	Het
Olfr683	T	A	7: 105,143,937	M119L	probably benign	Het
Olfr710	A	T	7: 106,944,173	V276E	probably damaging	Het
Olfr979	A	G	9: 40,000,564	V221A	probably benign	Het
Pcdh10	A	T	3: 45,383,572	R891S	possibly damaging	Het
Pcdh15	C	T	10: 74,631,770	S1873L	possibly damaging	Het
Pcdh7	A	G	5: 57,720,998	K632E	probably benign	Het
Pcdhgb8	G	A	18: 37,763,427	A517T	probably damaging	Het
Ptgr2	A	T	12: 84,292,298		probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Racgap1	T	A	15: 99,642,958	T4S	probably benign	Het
Rb1cc1	A	G	1: 6,249,180	H941R	probably benign	Het
Reln	T	C	5: 22,103,435	H312R	probably damaging	Het
Rnf166	T	A	8: 122,467,987	H208L	probably damaging	Het
Theg	T	C	10: 79,576,715	E314G	probably damaging	Het
Timeless	T	C	10: 128,250,426	S999P	probably benign	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tor1aip1	A	T	1: 156,007,609	H349Q	possibly damaging	Het
Ttn	T	A	2: 76,920,460	E3415V	probably benign	Het
Vmn2r102	A	T	17: 19,676,624	N78Y	probably damaging	Het
Wdr11	A	T	7: 129,607,086	D427V	probably damaging	Het
Zer1	A	T	2: 30,113,437		probably benign	Het
Zfp516	T	A	18: 82,957,108	M477K	probably benign	Het

Other mutations in Hgf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Hgf	APN	5	16611882	missense	possibly damaging	0.70
IGL00427:Hgf	APN	5	16578486	missense	probably benign	0.09
IGL00788:Hgf	APN	5	16598230	missense	probably damaging	0.99
IGL01290:Hgf	APN	5	16604846	missense	probably damaging	1.00
IGL01333:Hgf	APN	5	16576941	nonsense	probably null
IGL01568:Hgf	APN	5	16564814	missense	probably damaging	1.00
IGL02314:Hgf	APN	5	16572602	missense	probably damaging	0.99
IGL02328:Hgf	APN	5	16598221	missense	probably damaging	1.00
IGL02368:Hgf	APN	5	16564794	missense	possibly damaging	0.95
IGL02486:Hgf	APN	5	16602289	missense	probably damaging	1.00
IGL02654:Hgf	APN	5	16561051	missense	probably benign
Foiegras	UTSW	5	16615802	missense	probably benign	0.01
PIT4378001:Hgf	UTSW	5	16611862	missense	probably damaging	1.00
R0708:Hgf	UTSW	5	16566763	nonsense	probably null
R0710:Hgf	UTSW	5	16566763	nonsense	probably null
R0718:Hgf	UTSW	5	16593859	missense	probably damaging	1.00
R0967:Hgf	UTSW	5	16593841	splice site	probably benign
R1181:Hgf	UTSW	5	16618925	missense	probably damaging	1.00
R1589:Hgf	UTSW	5	16613785	missense	probably damaging	1.00
R1705:Hgf	UTSW	5	16615802	missense	probably benign	0.01
R1983:Hgf	UTSW	5	16561012	missense	possibly damaging	0.53
R2021:Hgf	UTSW	5	16576921	missense	probably benign
R2441:Hgf	UTSW	5	16604790	missense	probably damaging	0.99
R4083:Hgf	UTSW	5	16615858	nonsense	probably null
R4084:Hgf	UTSW	5	16615858	nonsense	probably null
R4211:Hgf	UTSW	5	16614993	missense	probably damaging	0.99
R4388:Hgf	UTSW	5	16614943	missense	probably benign	0.12
R4394:Hgf	UTSW	5	16618951	nonsense	probably null
R4575:Hgf	UTSW	5	16572601	missense	probably benign
R5044:Hgf	UTSW	5	16614894	missense	probably benign	0.00
R5319:Hgf	UTSW	5	16566862	critical splice donor site	probably null
R5585:Hgf	UTSW	5	16564801	missense	possibly damaging	0.93
R5700:Hgf	UTSW	5	16610124	missense	probably damaging	1.00
R5814:Hgf	UTSW	5	16602307	missense	probably benign	0.19
R6125:Hgf	UTSW	5	16598161	missense	probably damaging	1.00
R6749:Hgf	UTSW	5	16613642	splice site	probably null
R6891:Hgf	UTSW	5	16604922	critical splice donor site	probably null
R6962:Hgf	UTSW	5	16615754	missense	probably benign	0.32
R7251:Hgf	UTSW	5	16593944	missense	possibly damaging	0.95
R7296:Hgf	UTSW	5	16564843	missense	probably benign	0.39
R7470:Hgf	UTSW	5	16618856	missense	probably benign	0.02
R7630:Hgf	UTSW	5	16598250	missense	probably benign	0.01
R7807:Hgf	UTSW	5	16577011	missense	probably damaging	0.99
R8098:Hgf	UTSW	5	16561061	missense	probably benign	0.04
R8120:Hgf	UTSW	5	16613781	missense	probably damaging	1.00
R8132:Hgf	UTSW	5	16602331	missense	probably damaging	1.00
R8499:Hgf	UTSW	5	16566856	missense	probably damaging	0.99
X0024:Hgf	UTSW	5	16604828	missense	probably damaging	1.00
Z1088:Hgf	UTSW	5	16618919	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACAGGTCTACTAACATGGACC -3'
(R):5'- CTGCTTAGATCCAGCCTGTTAG -3'

Sequencing Primer
(F):5'- GAGGACCCTACTGTATCATCTATGG -3'
(R):5'- TTAGATCCAGCCTGTTAGAGGAAAAG -3'

Posted On

2019-10-07