Incidental Mutation 'R7463:Aebp2'
ID578556
Institutional Source Beutler Lab
Gene Symbol Aebp2
Ensembl Gene ENSMUSG00000030232
Gene NameAE binding protein 2
SynonymsB230313N05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7463 (G1)
Quality Score196.009
Status Validated
Chromosome6
Chromosomal Location140622663-140678472 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 140637726 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 309 (Q309*)
Ref Sequence ENSEMBL: ENSMUSP00000092993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032359] [ENSMUST00000087614] [ENSMUST00000095350] [ENSMUST00000160836] [ENSMUST00000161335]
Predicted Effect probably null
Transcript: ENSMUST00000032359
AA Change: Q87*
SMART Domains Protein: ENSMUSP00000032359
Gene: ENSMUSG00000030232
AA Change: Q87*

DomainStartEndE-ValueType
ZnF_C2H2 32 57 1.26e-2 SMART
ZnF_C2H2 66 93 5.92e0 SMART
ZnF_C2H2 99 123 2.2e-2 SMART
low complexity region 149 165 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000087614
AA Change: Q309*
SMART Domains Protein: ENSMUSP00000084896
Gene: ENSMUSG00000030232
AA Change: Q309*

DomainStartEndE-ValueType
low complexity region 1 71 N/A INTRINSIC
low complexity region 81 124 N/A INTRINSIC
low complexity region 128 199 N/A INTRINSIC
ZnF_C2H2 254 279 1.26e-2 SMART
ZnF_C2H2 288 315 5.92e0 SMART
ZnF_C2H2 321 345 2.2e-2 SMART
low complexity region 371 387 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000095350
AA Change: Q309*
SMART Domains Protein: ENSMUSP00000092993
Gene: ENSMUSG00000030232
AA Change: Q309*

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
ZnF_C2H2 77 102 1.26e-2 SMART
ZnF_C2H2 111 138 5.92e0 SMART
ZnF_C2H2 144 168 2.2e-2 SMART
low complexity region 194 210 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160836
AA Change: Q87*
SMART Domains Protein: ENSMUSP00000124148
Gene: ENSMUSG00000030232
AA Change: Q87*

DomainStartEndE-ValueType
ZnF_C2H2 32 57 1.26e-2 SMART
ZnF_C2H2 66 93 5.92e0 SMART
ZnF_C2H2 99 123 2.2e-2 SMART
low complexity region 149 165 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161335
AA Change: Q87*
SMART Domains Protein: ENSMUSP00000125479
Gene: ENSMUSG00000030232
AA Change: Q87*

DomainStartEndE-ValueType
ZnF_C2H2 32 57 1.26e-2 SMART
ZnF_C2H2 66 93 5.92e0 SMART
ZnF_C2H2 99 123 2.2e-2 SMART
low complexity region 149 165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162903
SMART Domains Protein: ENSMUSP00000123897
Gene: ENSMUSG00000030232

DomainStartEndE-ValueType
ZnF_C2H2 2 26 2.2e-2 SMART
low complexity region 52 68 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a mutation in this gene show complete embryonic lethality. Heterozygous mutant mice show aganglionic megacolon, hypopigmentation of the tail tip and hind toes, and a decreased startle reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,772 V435E probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy2 T C 13: 68,730,280 D413G probably damaging Het
Adgrg6 T A 10: 14,434,396 D727V possibly damaging Het
Amy1 A T 3: 113,569,884 C43* probably null Het
Bpifc T C 10: 85,979,334 E256G probably benign Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Carmil3 C T 14: 55,502,396 P980L probably damaging Het
Coch T A 12: 51,593,625 M1K probably null Het
Cpt2 A T 4: 107,908,157 F137I probably damaging Het
Crem T C 18: 3,295,094 I112V probably benign Het
Cul9 A G 17: 46,520,476 probably null Het
Cyp3a41a T A 5: 145,713,564 I90F probably damaging Het
Cyp4f16 C T 17: 32,550,787 A457V possibly damaging Het
Ddx6 A G 9: 44,628,729 E318G probably damaging Het
Dip2b A G 15: 100,154,157 E213G probably benign Het
Dlx5 T C 6: 6,878,316 H238R probably damaging Het
Dnaic2 A C 11: 114,754,406 I556L probably benign Het
Dnmt1 C T 9: 20,912,225 V1147M possibly damaging Het
Egf G T 3: 129,740,015 Q59K probably benign Het
Ermp1 A T 19: 29,646,262 Y109* probably null Het
Fer1l6 T A 15: 58,573,601 Y573* probably null Het
Fmnl1 T C 11: 103,193,128 L503P probably damaging Het
Gnptab T G 10: 88,431,389 I447M probably damaging Het
Hgf G A 5: 16,578,450 D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Igf2r T C 17: 12,710,645 T958A probably benign Het
Kcnd2 T A 6: 21,216,498 L67Q probably damaging Het
Kif5a A G 10: 127,243,724 V248A probably damaging Het
Krt33b A G 11: 100,029,563 I88T probably damaging Het
Lhx2 G A 2: 38,351,846 E25K possibly damaging Het
Mex3d C T 10: 80,381,698 G562R Het
Myom2 A T 8: 15,117,679 Y1088F probably null Het
Ncapg T A 5: 45,694,092 probably null Het
Nudc A C 4: 133,534,403 V190G possibly damaging Het
Obscn G T 11: 59,122,860 R1054S probably benign Het
Olfr1045 T C 2: 86,197,838 M305V probably benign Het
Olfr1510 A G 14: 52,410,711 W54R probably benign Het
Olfr651 T C 7: 104,553,482 S188P possibly damaging Het
Olfr683 T A 7: 105,143,937 M119L probably benign Het
Olfr710 A T 7: 106,944,173 V276E probably damaging Het
Olfr979 A G 9: 40,000,564 V221A probably benign Het
Pcdh10 A T 3: 45,383,572 R891S possibly damaging Het
Pcdh15 C T 10: 74,631,770 S1873L possibly damaging Het
Pcdh7 A G 5: 57,720,998 K632E probably benign Het
Pcdhgb8 G A 18: 37,763,427 A517T probably damaging Het
Ptgr2 A T 12: 84,292,298 probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Racgap1 T A 15: 99,642,958 T4S probably benign Het
Rb1cc1 A G 1: 6,249,180 H941R probably benign Het
Reln T C 5: 22,103,435 H312R probably damaging Het
Rnf166 T A 8: 122,467,987 H208L probably damaging Het
Theg T C 10: 79,576,715 E314G probably damaging Het
Timeless T C 10: 128,250,426 S999P probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tor1aip1 A T 1: 156,007,609 H349Q possibly damaging Het
Ttn T A 2: 76,920,460 E3415V probably benign Het
Vmn2r102 A T 17: 19,676,624 N78Y probably damaging Het
Wdr11 A T 7: 129,607,086 D427V probably damaging Het
Zer1 A T 2: 30,113,437 probably benign Het
Zfp516 T A 18: 82,957,108 M477K probably benign Het
Other mutations in Aebp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Aebp2 APN 6 140642254 missense probably benign 0.29
IGL01935:Aebp2 APN 6 140637657 unclassified probably benign
IGL02149:Aebp2 APN 6 140642284 missense probably benign 0.06
PIT4453001:Aebp2 UTSW 6 140637686 nonsense probably null
R0030:Aebp2 UTSW 6 140637747 missense probably damaging 0.99
R0091:Aebp2 UTSW 6 140644074 critical splice donor site probably null
R0744:Aebp2 UTSW 6 140642364 splice site probably null
R1603:Aebp2 UTSW 6 140642253 missense probably damaging 0.98
R1990:Aebp2 UTSW 6 140633738 missense probably damaging 1.00
R2073:Aebp2 UTSW 6 140633694 missense probably benign 0.41
R2075:Aebp2 UTSW 6 140633694 missense probably benign 0.41
R2971:Aebp2 UTSW 6 140633898 critical splice donor site probably null
R3805:Aebp2 UTSW 6 140643949 frame shift probably null
R3911:Aebp2 UTSW 6 140647981 missense probably damaging 1.00
R3921:Aebp2 UTSW 6 140633735 missense probably damaging 1.00
R4020:Aebp2 UTSW 6 140642295 missense probably damaging 1.00
R4374:Aebp2 UTSW 6 140654258 utr 3 prime probably benign
R4856:Aebp2 UTSW 6 140644073 critical splice donor site probably null
R5022:Aebp2 UTSW 6 140637730 missense possibly damaging 0.90
R5140:Aebp2 UTSW 6 140633806 nonsense probably null
R5761:Aebp2 UTSW 6 140624217 unclassified probably benign
R6983:Aebp2 UTSW 6 140637663 missense possibly damaging 0.91
R7168:Aebp2 UTSW 6 140633700 missense probably damaging 0.98
R7259:Aebp2 UTSW 6 140633768 missense probably benign 0.03
R7556:Aebp2 UTSW 6 140677411 missense probably benign 0.07
R7654:Aebp2 UTSW 6 140653748 splice site probably null
R7745:Aebp2 UTSW 6 140623858 missense unknown
R8258:Aebp2 UTSW 6 140637727 missense possibly damaging 0.82
R8259:Aebp2 UTSW 6 140637727 missense possibly damaging 0.82
Z1177:Aebp2 UTSW 6 140624094 missense unknown
Predicted Primers PCR Primer
(F):5'- CATTGAGTGCACAGTGTTTATCAG -3'
(R):5'- AGAAGGCCCAAAGTATGCTCAC -3'

Sequencing Primer
(F):5'- ACGAGGATCCAAAGTCTT -3'
(R):5'- TATGGTGGCTCAACCTGAAATGC -3'
Posted On2019-10-07