Incidental Mutation 'R7463:Wdr11'
ID 578560
Institutional Source Beutler Lab
Gene Symbol Wdr11
Ensembl Gene ENSMUSG00000042055
Gene Name WD repeat domain 11
Synonyms Brwd2, Wdr11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock # R7463 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 129591863-129635738 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 129607086 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 427 (D427V)
Ref Sequence ENSEMBL: ENSMUSP00000081567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084519]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000084519
AA Change: D427V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081567
Gene: ENSMUSG00000042055
AA Change: D427V

DomainStartEndE-ValueType
WD40 50 99 2e-1 SMART
WD40 102 145 2.84e2 SMART
low complexity region 189 200 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
low complexity region 454 465 N/A INTRINSIC
WD40 552 595 4.42e1 SMART
WD40 696 735 1.66e0 SMART
WD40 737 777 1.43e1 SMART
WD40 780 821 1.38e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148752
Predicted Effect probably benign
Transcript: ENSMUST00000206442
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is located in the chromosome 10q25-26 region, which is frequently deleted in gliomas and tumors of other tissues, and is disrupted by the t(10;19) translocation rearrangement in glioblastoma cells. The gene location suggests that it is a candidate gene for the tumor suppressor locus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,772 V435E probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy2 T C 13: 68,730,280 D413G probably damaging Het
Adgrg6 T A 10: 14,434,396 D727V possibly damaging Het
Aebp2 C T 6: 140,637,726 Q309* probably null Het
Amy1 A T 3: 113,569,884 C43* probably null Het
Bpifc T C 10: 85,979,334 E256G probably benign Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Carmil3 C T 14: 55,502,396 P980L probably damaging Het
Coch T A 12: 51,593,625 M1K probably null Het
Cpt2 A T 4: 107,908,157 F137I probably damaging Het
Crem T C 18: 3,295,094 I112V probably benign Het
Cul9 A G 17: 46,520,476 probably null Het
Cyp3a41a T A 5: 145,713,564 I90F probably damaging Het
Cyp4f16 C T 17: 32,550,787 A457V possibly damaging Het
Ddx6 A G 9: 44,628,729 E318G probably damaging Het
Dip2b A G 15: 100,154,157 E213G probably benign Het
Dlx5 T C 6: 6,878,316 H238R probably damaging Het
Dnaic2 A C 11: 114,754,406 I556L probably benign Het
Dnmt1 C T 9: 20,912,225 V1147M possibly damaging Het
Egf G T 3: 129,740,015 Q59K probably benign Het
Ermp1 A T 19: 29,646,262 Y109* probably null Het
Fer1l6 T A 15: 58,573,601 Y573* probably null Het
Fmnl1 T C 11: 103,193,128 L503P probably damaging Het
Gnptab T G 10: 88,431,389 I447M probably damaging Het
Hgf G A 5: 16,578,450 D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Igf2r T C 17: 12,710,645 T958A probably benign Het
Kcnd2 T A 6: 21,216,498 L67Q probably damaging Het
Kif5a A G 10: 127,243,724 V248A probably damaging Het
Krt33b A G 11: 100,029,563 I88T probably damaging Het
Lhx2 G A 2: 38,351,846 E25K possibly damaging Het
Mex3d C T 10: 80,381,698 G562R Het
Myom2 A T 8: 15,117,679 Y1088F probably null Het
Ncapg T A 5: 45,694,092 probably null Het
Nudc A C 4: 133,534,403 V190G possibly damaging Het
Obscn G T 11: 59,122,860 R1054S probably benign Het
Olfr1045 T C 2: 86,197,838 M305V probably benign Het
Olfr1510 A G 14: 52,410,711 W54R probably benign Het
Olfr651 T C 7: 104,553,482 S188P possibly damaging Het
Olfr683 T A 7: 105,143,937 M119L probably benign Het
Olfr710 A T 7: 106,944,173 V276E probably damaging Het
Olfr979 A G 9: 40,000,564 V221A probably benign Het
Pcdh10 A T 3: 45,383,572 R891S possibly damaging Het
Pcdh15 C T 10: 74,631,770 S1873L possibly damaging Het
Pcdh7 A G 5: 57,720,998 K632E probably benign Het
Pcdhgb8 G A 18: 37,763,427 A517T probably damaging Het
Ptgr2 A T 12: 84,292,298 probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Racgap1 T A 15: 99,642,958 T4S probably benign Het
Rb1cc1 A G 1: 6,249,180 H941R probably benign Het
Reln T C 5: 22,103,435 H312R probably damaging Het
Rnf166 T A 8: 122,467,987 H208L probably damaging Het
Theg T C 10: 79,576,715 E314G probably damaging Het
Timeless T C 10: 128,250,426 S999P probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tor1aip1 A T 1: 156,007,609 H349Q possibly damaging Het
Ttn T A 2: 76,920,460 E3415V probably benign Het
Vmn2r102 A T 17: 19,676,624 N78Y probably damaging Het
Zer1 A T 2: 30,113,437 probably benign Het
Zfp516 T A 18: 82,957,108 M477K probably benign Het
Other mutations in Wdr11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Wdr11 APN 7 129593093 splice site probably null
IGL01121:Wdr11 APN 7 129628022 missense probably benign 0.02
IGL01385:Wdr11 APN 7 129607913 missense probably benign
IGL01923:Wdr11 APN 7 129632322 critical splice acceptor site probably null
IGL02274:Wdr11 APN 7 129631172 critical splice acceptor site probably null
IGL02894:Wdr11 APN 7 129631166 splice site probably benign
IGL02927:Wdr11 APN 7 129607098 critical splice donor site probably null
IGL03008:Wdr11 APN 7 129606991 unclassified probably benign
IGL03026:Wdr11 APN 7 129624336 missense probably damaging 1.00
IGL03354:Wdr11 APN 7 129625302 missense probably benign 0.01
IGL03379:Wdr11 APN 7 129599123 missense probably damaging 1.00
Propeller UTSW 7 129606675 missense possibly damaging 0.91
R0003:Wdr11 UTSW 7 129599061 missense probably damaging 1.00
R0928:Wdr11 UTSW 7 129606653 missense probably damaging 1.00
R1170:Wdr11 UTSW 7 129607107 unclassified probably benign
R1645:Wdr11 UTSW 7 129613889 missense probably benign 0.29
R1908:Wdr11 UTSW 7 129605230 missense possibly damaging 0.60
R1938:Wdr11 UTSW 7 129606607 missense probably benign 0.08
R2122:Wdr11 UTSW 7 129631766 missense probably damaging 1.00
R2148:Wdr11 UTSW 7 129629083 splice site probably null
R2240:Wdr11 UTSW 7 129605694 critical splice acceptor site probably null
R2362:Wdr11 UTSW 7 129634836 missense probably benign 0.05
R3774:Wdr11 UTSW 7 129631693 splice site probably null
R4297:Wdr11 UTSW 7 129625186 missense probably benign 0.18
R4546:Wdr11 UTSW 7 129629005 missense probably damaging 1.00
R4787:Wdr11 UTSW 7 129608934 splice site probably benign
R4789:Wdr11 UTSW 7 129618670 nonsense probably null
R4807:Wdr11 UTSW 7 129628022 missense probably benign 0.02
R4855:Wdr11 UTSW 7 129600434 splice site probably null
R4898:Wdr11 UTSW 7 129633721 missense probably benign
R5022:Wdr11 UTSW 7 129624711 missense probably benign 0.10
R5326:Wdr11 UTSW 7 129625249 missense probably damaging 1.00
R5398:Wdr11 UTSW 7 129631232 missense probably damaging 1.00
R6120:Wdr11 UTSW 7 129624791 missense probably damaging 0.99
R6136:Wdr11 UTSW 7 129618703 missense possibly damaging 0.86
R6280:Wdr11 UTSW 7 129599106 nonsense probably null
R6352:Wdr11 UTSW 7 129606675 missense possibly damaging 0.91
R6432:Wdr11 UTSW 7 129606518 missense possibly damaging 0.83
R6766:Wdr11 UTSW 7 129624312 missense probably benign 0.02
R6911:Wdr11 UTSW 7 129607095 missense probably benign 0.28
R7135:Wdr11 UTSW 7 129628106 missense possibly damaging 0.76
R7151:Wdr11 UTSW 7 129606652 missense probably damaging 1.00
R7503:Wdr11 UTSW 7 129603110 missense probably benign
R8097:Wdr11 UTSW 7 129607887 missense probably damaging 1.00
R8254:Wdr11 UTSW 7 129634836 missense probably benign 0.02
R8354:Wdr11 UTSW 7 129602999 missense probably damaging 0.99
R8377:Wdr11 UTSW 7 129606688 missense possibly damaging 0.56
R8416:Wdr11 UTSW 7 129630679 missense possibly damaging 0.62
R8708:Wdr11 UTSW 7 129599056 missense probably benign 0.07
R8896:Wdr11 UTSW 7 129605713 nonsense probably null
R9092:Wdr11 UTSW 7 129624727 missense probably damaging 0.97
R9136:Wdr11 UTSW 7 129603092 missense
R9315:Wdr11 UTSW 7 129606540 missense probably benign 0.13
Z1177:Wdr11 UTSW 7 129607878 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTTGCTTCACTGTGGCC -3'
(R):5'- TAGAGCAGAGCCTTCAACCC -3'

Sequencing Primer
(F):5'- CTGTGGCCAAGATTAATAATTGCTGC -3'
(R):5'- TTTTCTAAATCCAACAACTGCAGAGC -3'
Posted On 2019-10-07