Mutagenetix > Incidental Mutations

Incidental Mutation 'R7463:Wdr11'

578560

Institutional Source

Beutler Lab

Gene Symbol

Wdr11

Ensembl Gene

ENSMUSG00000042055

Gene Name

WD repeat domain 11

Synonyms

Brwd2, Wdr11

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.249) question?

Stock #

R7463 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

129591863-129635738 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 129607086 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 427 (D427V)

Ref Sequence

ENSEMBL: ENSMUSP00000081567 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084519]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000084519
AA Change: D427V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000081567
Gene: ENSMUSG00000042055
AA Change: D427V

Domain	Start	End	E-Value	Type
WD40	50	99	2e-1	SMART
WD40	102	145	2.84e2	SMART
low complexity region	189	200	N/A	INTRINSIC
low complexity region	213	227	N/A	INTRINSIC
low complexity region	454	465	N/A	INTRINSIC
WD40	552	595	4.42e1	SMART
WD40	696	735	1.66e0	SMART
WD40	737	777	1.43e1	SMART
WD40	780	821	1.38e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000148752

Predicted Effect

probably benign
Transcript: ENSMUST00000206442

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.7%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is located in the chromosome 10q25-26 region, which is frequently deleted in gliomas and tumors of other tissues, and is disrupted by the t(10;19) translocation rearrangement in glioblastoma cells. The gene location suggests that it is a candidate gene for the tumor suppressor locus. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	A	T	17: 46,323,772	V435E	probably damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adcy2	T	C	13: 68,730,280	D413G	probably damaging	Het
Adgrg6	T	A	10: 14,434,396	D727V	possibly damaging	Het
Aebp2	C	T	6: 140,637,726	Q309*	probably null	Het
Amy1	A	T	3: 113,569,884	C43*	probably null	Het
Bpifc	T	C	10: 85,979,334	E256G	probably benign	Het
Bysl	A	T	17: 47,602,471	S296T	probably benign	Het
Carmil3	C	T	14: 55,502,396	P980L	probably damaging	Het
Coch	T	A	12: 51,593,625	M1K	probably null	Het
Cpt2	A	T	4: 107,908,157	F137I	probably damaging	Het
Crem	T	C	18: 3,295,094	I112V	probably benign	Het
Cul9	A	G	17: 46,520,476		probably null	Het
Cyp3a41a	T	A	5: 145,713,564	I90F	probably damaging	Het
Cyp4f16	C	T	17: 32,550,787	A457V	possibly damaging	Het
Ddx6	A	G	9: 44,628,729	E318G	probably damaging	Het
Dip2b	A	G	15: 100,154,157	E213G	probably benign	Het
Dlx5	T	C	6: 6,878,316	H238R	probably damaging	Het
Dnaic2	A	C	11: 114,754,406	I556L	probably benign	Het
Dnmt1	C	T	9: 20,912,225	V1147M	possibly damaging	Het
Egf	G	T	3: 129,740,015	Q59K	probably benign	Het
Ermp1	A	T	19: 29,646,262	Y109*	probably null	Het
Fer1l6	T	A	15: 58,573,601	Y573*	probably null	Het
Fmnl1	T	C	11: 103,193,128	L503P	probably damaging	Het
Gnptab	T	G	10: 88,431,389	I447M	probably damaging	Het
Hgf	G	A	5: 16,578,450	D253N	probably benign	Het
Hjurp	CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT	C	1: 88,266,277		probably benign	Het
Igf2r	T	C	17: 12,710,645	T958A	probably benign	Het
Kcnd2	T	A	6: 21,216,498	L67Q	probably damaging	Het
Kif5a	A	G	10: 127,243,724	V248A	probably damaging	Het
Krt33b	A	G	11: 100,029,563	I88T	probably damaging	Het
Lhx2	G	A	2: 38,351,846	E25K	possibly damaging	Het
Mex3d	C	T	10: 80,381,698	G562R		Het
Myom2	A	T	8: 15,117,679	Y1088F	probably null	Het
Ncapg	T	A	5: 45,694,092		probably null	Het
Nudc	A	C	4: 133,534,403	V190G	possibly damaging	Het
Obscn	G	T	11: 59,122,860	R1054S	probably benign	Het
Olfr1045	T	C	2: 86,197,838	M305V	probably benign	Het
Olfr1510	A	G	14: 52,410,711	W54R	probably benign	Het
Olfr651	T	C	7: 104,553,482	S188P	possibly damaging	Het
Olfr683	T	A	7: 105,143,937	M119L	probably benign	Het
Olfr710	A	T	7: 106,944,173	V276E	probably damaging	Het
Olfr979	A	G	9: 40,000,564	V221A	probably benign	Het
Pcdh10	A	T	3: 45,383,572	R891S	possibly damaging	Het
Pcdh15	C	T	10: 74,631,770	S1873L	possibly damaging	Het
Pcdh7	A	G	5: 57,720,998	K632E	probably benign	Het
Pcdhgb8	G	A	18: 37,763,427	A517T	probably damaging	Het
Ptgr2	A	T	12: 84,292,298		probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Racgap1	T	A	15: 99,642,958	T4S	probably benign	Het
Rb1cc1	A	G	1: 6,249,180	H941R	probably benign	Het
Reln	T	C	5: 22,103,435	H312R	probably damaging	Het
Rnf166	T	A	8: 122,467,987	H208L	probably damaging	Het
Theg	T	C	10: 79,576,715	E314G	probably damaging	Het
Timeless	T	C	10: 128,250,426	S999P	probably benign	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tor1aip1	A	T	1: 156,007,609	H349Q	possibly damaging	Het
Ttn	T	A	2: 76,920,460	E3415V	probably benign	Het
Vmn2r102	A	T	17: 19,676,624	N78Y	probably damaging	Het
Zer1	A	T	2: 30,113,437		probably benign	Het
Zfp516	T	A	18: 82,957,108	M477K	probably benign	Het

Other mutations in Wdr11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00834:Wdr11	APN	7	129593093	splice site	probably null
IGL01121:Wdr11	APN	7	129628022	missense	probably benign	0.02
IGL01385:Wdr11	APN	7	129607913	missense	probably benign
IGL01923:Wdr11	APN	7	129632322	critical splice acceptor site	probably null
IGL02274:Wdr11	APN	7	129631172	critical splice acceptor site	probably null
IGL02894:Wdr11	APN	7	129631166	splice site	probably benign
IGL02927:Wdr11	APN	7	129607098	critical splice donor site	probably null
IGL03008:Wdr11	APN	7	129606991	unclassified	probably benign
IGL03026:Wdr11	APN	7	129624336	missense	probably damaging	1.00
IGL03354:Wdr11	APN	7	129625302	missense	probably benign	0.01
IGL03379:Wdr11	APN	7	129599123	missense	probably damaging	1.00
Propeller	UTSW	7	129606675	missense	possibly damaging	0.91
R0003:Wdr11	UTSW	7	129599061	missense	probably damaging	1.00
R0928:Wdr11	UTSW	7	129606653	missense	probably damaging	1.00
R1170:Wdr11	UTSW	7	129607107	unclassified	probably benign
R1645:Wdr11	UTSW	7	129613889	missense	probably benign	0.29
R1908:Wdr11	UTSW	7	129605230	missense	possibly damaging	0.60
R1938:Wdr11	UTSW	7	129606607	missense	probably benign	0.08
R2122:Wdr11	UTSW	7	129631766	missense	probably damaging	1.00
R2148:Wdr11	UTSW	7	129629083	splice site	probably null
R2240:Wdr11	UTSW	7	129605694	critical splice acceptor site	probably null
R2362:Wdr11	UTSW	7	129634836	missense	probably benign	0.05
R3774:Wdr11	UTSW	7	129631693	splice site	probably null
R4297:Wdr11	UTSW	7	129625186	missense	probably benign	0.18
R4546:Wdr11	UTSW	7	129629005	missense	probably damaging	1.00
R4787:Wdr11	UTSW	7	129608934	splice site	probably benign
R4789:Wdr11	UTSW	7	129618670	nonsense	probably null
R4807:Wdr11	UTSW	7	129628022	missense	probably benign	0.02
R4855:Wdr11	UTSW	7	129600434	splice site	probably null
R4898:Wdr11	UTSW	7	129633721	missense	probably benign
R5022:Wdr11	UTSW	7	129624711	missense	probably benign	0.10
R5326:Wdr11	UTSW	7	129625249	missense	probably damaging	1.00
R5398:Wdr11	UTSW	7	129631232	missense	probably damaging	1.00
R6120:Wdr11	UTSW	7	129624791	missense	probably damaging	0.99
R6136:Wdr11	UTSW	7	129618703	missense	possibly damaging	0.86
R6280:Wdr11	UTSW	7	129599106	nonsense	probably null
R6352:Wdr11	UTSW	7	129606675	missense	possibly damaging	0.91
R6432:Wdr11	UTSW	7	129606518	missense	possibly damaging	0.83
R6766:Wdr11	UTSW	7	129624312	missense	probably benign	0.02
R6911:Wdr11	UTSW	7	129607095	missense	probably benign	0.28
R7135:Wdr11	UTSW	7	129628106	missense	possibly damaging	0.76
R7151:Wdr11	UTSW	7	129606652	missense	probably damaging	1.00
R7503:Wdr11	UTSW	7	129603110	missense	probably benign
R8097:Wdr11	UTSW	7	129607887	missense	probably damaging	1.00
R8254:Wdr11	UTSW	7	129634836	missense	probably benign	0.02
R8354:Wdr11	UTSW	7	129602999	missense	probably damaging	0.99
R8377:Wdr11	UTSW	7	129606688	missense	possibly damaging	0.56
R8416:Wdr11	UTSW	7	129630679	missense	possibly damaging	0.62
R8708:Wdr11	UTSW	7	129599056	missense	probably benign	0.07
R8896:Wdr11	UTSW	7	129605713	nonsense	probably null
R9092:Wdr11	UTSW	7	129624727	missense	probably damaging	0.97
R9136:Wdr11	UTSW	7	129603092	missense
R9315:Wdr11	UTSW	7	129606540	missense	probably benign	0.13
Z1177:Wdr11	UTSW	7	129607878	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGTTGCTTCACTGTGGCC -3'
(R):5'- TAGAGCAGAGCCTTCAACCC -3'

Sequencing Primer
(F):5'- CTGTGGCCAAGATTAATAATTGCTGC -3'
(R):5'- TTTTCTAAATCCAACAACTGCAGAGC -3'

Posted On

2019-10-07