Incidental Mutation 'R7463:Myom2'
ID578561
Institutional Source Beutler Lab
Gene Symbol Myom2
Ensembl Gene ENSMUSG00000031461
Gene Namemyomesin 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R7463 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location15057653-15133541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15117679 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1088 (Y1088F)
Ref Sequence ENSEMBL: ENSMUSP00000033842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033842]
Predicted Effect probably null
Transcript: ENSMUST00000033842
AA Change: Y1088F

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033842
Gene: ENSMUSG00000031461
AA Change: Y1088F

DomainStartEndE-ValueType
low complexity region 34 63 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
coiled coil region 97 129 N/A INTRINSIC
IG 160 247 7.7e-5 SMART
IG 284 373 8.01e-3 SMART
FN3 383 466 1.5e-14 SMART
FN3 511 594 1.79e-12 SMART
FN3 612 693 1.95e-13 SMART
FN3 711 794 8.69e-11 SMART
FN3 813 896 1.86e-10 SMART
IG_like 913 999 1.58e2 SMART
Blast:IG_like 1021 1106 1e-44 BLAST
IG_like 1135 1215 2.27e1 SMART
Blast:IG_like 1227 1321 9e-51 BLAST
IGc2 1357 1425 4.96e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,772 V435E probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy2 T C 13: 68,730,280 D413G probably damaging Het
Adgrg6 T A 10: 14,434,396 D727V possibly damaging Het
Aebp2 C T 6: 140,637,726 Q309* probably null Het
Amy1 A T 3: 113,569,884 C43* probably null Het
Bpifc T C 10: 85,979,334 E256G probably benign Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Carmil3 C T 14: 55,502,396 P980L probably damaging Het
Coch T A 12: 51,593,625 M1K probably null Het
Cpt2 A T 4: 107,908,157 F137I probably damaging Het
Crem T C 18: 3,295,094 I112V probably benign Het
Cul9 A G 17: 46,520,476 probably null Het
Cyp3a41a T A 5: 145,713,564 I90F probably damaging Het
Cyp4f16 C T 17: 32,550,787 A457V possibly damaging Het
Ddx6 A G 9: 44,628,729 E318G probably damaging Het
Dip2b A G 15: 100,154,157 E213G probably benign Het
Dlx5 T C 6: 6,878,316 H238R probably damaging Het
Dnaic2 A C 11: 114,754,406 I556L probably benign Het
Dnmt1 C T 9: 20,912,225 V1147M possibly damaging Het
Egf G T 3: 129,740,015 Q59K probably benign Het
Ermp1 A T 19: 29,646,262 Y109* probably null Het
Fer1l6 T A 15: 58,573,601 Y573* probably null Het
Fmnl1 T C 11: 103,193,128 L503P probably damaging Het
Gnptab T G 10: 88,431,389 I447M probably damaging Het
Hgf G A 5: 16,578,450 D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Igf2r T C 17: 12,710,645 T958A probably benign Het
Kcnd2 T A 6: 21,216,498 L67Q probably damaging Het
Kif5a A G 10: 127,243,724 V248A probably damaging Het
Krt33b A G 11: 100,029,563 I88T probably damaging Het
Lhx2 G A 2: 38,351,846 E25K possibly damaging Het
Mex3d C T 10: 80,381,698 G562R Het
Ncapg T A 5: 45,694,092 probably null Het
Nudc A C 4: 133,534,403 V190G possibly damaging Het
Obscn G T 11: 59,122,860 R1054S probably benign Het
Olfr1045 T C 2: 86,197,838 M305V probably benign Het
Olfr1510 A G 14: 52,410,711 W54R probably benign Het
Olfr651 T C 7: 104,553,482 S188P possibly damaging Het
Olfr683 T A 7: 105,143,937 M119L probably benign Het
Olfr710 A T 7: 106,944,173 V276E probably damaging Het
Olfr979 A G 9: 40,000,564 V221A probably benign Het
Pcdh10 A T 3: 45,383,572 R891S possibly damaging Het
Pcdh15 C T 10: 74,631,770 S1873L possibly damaging Het
Pcdh7 A G 5: 57,720,998 K632E probably benign Het
Pcdhgb8 G A 18: 37,763,427 A517T probably damaging Het
Ptgr2 A T 12: 84,292,298 probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Racgap1 T A 15: 99,642,958 T4S probably benign Het
Rb1cc1 A G 1: 6,249,180 H941R probably benign Het
Reln T C 5: 22,103,435 H312R probably damaging Het
Rnf166 T A 8: 122,467,987 H208L probably damaging Het
Theg T C 10: 79,576,715 E314G probably damaging Het
Timeless T C 10: 128,250,426 S999P probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tor1aip1 A T 1: 156,007,609 H349Q possibly damaging Het
Ttn T A 2: 76,920,460 E3415V probably benign Het
Vmn2r102 A T 17: 19,676,624 N78Y probably damaging Het
Wdr11 A T 7: 129,607,086 D427V probably damaging Het
Zer1 A T 2: 30,113,437 probably benign Het
Zfp516 T A 18: 82,957,108 M477K probably benign Het
Other mutations in Myom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom2 APN 8 15069490 missense probably damaging 1.00
IGL00426:Myom2 APN 8 15069502 missense probably benign 0.00
IGL00503:Myom2 APN 8 15114289 splice site probably null
IGL01515:Myom2 APN 8 15122655 missense probably benign 0.15
IGL01649:Myom2 APN 8 15113755 missense probably benign 0.24
IGL01658:Myom2 APN 8 15077880 missense probably damaging 1.00
IGL01786:Myom2 APN 8 15106330 missense probably damaging 0.99
IGL01924:Myom2 APN 8 15069685 missense probably benign 0.37
IGL01929:Myom2 APN 8 15117698 missense probably damaging 0.96
IGL02016:Myom2 APN 8 15125195 missense probably benign 0.01
IGL02511:Myom2 APN 8 15065743 missense probably benign
IGL02558:Myom2 APN 8 15114237 missense probably benign 0.31
IGL02944:Myom2 APN 8 15104065 critical splice acceptor site probably null
IGL03052:Myom2 APN 8 15123442 splice site probably benign
IGL03195:Myom2 APN 8 15111844 nonsense probably null
IGL03288:Myom2 APN 8 15122679 missense probably damaging 0.99
IGL03402:Myom2 APN 8 15065731 missense probably benign
yomama UTSW 8 15132895 missense probably benign 0.10
yoyoma UTSW 8 15132667 missense probably damaging 0.99
R0069:Myom2 UTSW 8 15117624 missense probably benign
R0116:Myom2 UTSW 8 15117633 missense probably damaging 1.00
R0131:Myom2 UTSW 8 15083329 missense probably damaging 0.98
R0373:Myom2 UTSW 8 15098419 missense possibly damaging 0.91
R0463:Myom2 UTSW 8 15104123 missense probably benign 0.09
R0544:Myom2 UTSW 8 15069796 missense probably damaging 1.00
R0629:Myom2 UTSW 8 15069783 missense probably damaging 0.98
R0634:Myom2 UTSW 8 15119216 splice site probably benign
R0645:Myom2 UTSW 8 15117698 missense probably damaging 0.96
R0730:Myom2 UTSW 8 15099326 missense probably benign 0.00
R0744:Myom2 UTSW 8 15132924 nonsense probably null
R0836:Myom2 UTSW 8 15132924 nonsense probably null
R1033:Myom2 UTSW 8 15108934 missense probably benign 0.04
R1103:Myom2 UTSW 8 15110827 missense probably benign 0.22
R1110:Myom2 UTSW 8 15122413 missense probably benign 0.44
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1353:Myom2 UTSW 8 15106424 missense probably damaging 1.00
R1530:Myom2 UTSW 8 15122384 missense probably damaging 1.00
R1544:Myom2 UTSW 8 15104059 splice site probably benign
R1576:Myom2 UTSW 8 15084556 missense probably damaging 1.00
R1758:Myom2 UTSW 8 15065795 missense probably benign 0.00
R1884:Myom2 UTSW 8 15114278 missense probably benign 0.01
R1908:Myom2 UTSW 8 15081023 missense probably damaging 1.00
R1962:Myom2 UTSW 8 15132599 splice site probably null
R1977:Myom2 UTSW 8 15085263 missense possibly damaging 0.47
R2018:Myom2 UTSW 8 15131151 missense probably damaging 1.00
R2049:Myom2 UTSW 8 15106379 missense probably damaging 0.97
R2155:Myom2 UTSW 8 15084555 missense probably damaging 0.98
R2314:Myom2 UTSW 8 15063927 missense probably damaging 0.99
R2350:Myom2 UTSW 8 15108835 missense probably benign 0.09
R2358:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R2904:Myom2 UTSW 8 15098348 missense probably benign 0.00
R3418:Myom2 UTSW 8 15085294 missense probably benign 0.01
R3606:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3607:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3735:Myom2 UTSW 8 15069676 missense probably benign 0.01
R3756:Myom2 UTSW 8 15102650 missense probably benign 0.11
R3902:Myom2 UTSW 8 15104165 missense probably benign
R3951:Myom2 UTSW 8 15084556 missense probably benign 0.35
R4240:Myom2 UTSW 8 15132895 missense probably benign 0.10
R4361:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R4581:Myom2 UTSW 8 15106459 missense probably benign 0.02
R4736:Myom2 UTSW 8 15081271 missense probably damaging 0.99
R5010:Myom2 UTSW 8 15083310 missense probably damaging 0.98
R5108:Myom2 UTSW 8 15132667 missense probably damaging 0.99
R5370:Myom2 UTSW 8 15099343 missense probably benign 0.10
R5427:Myom2 UTSW 8 15113764 missense probably benign 0.03
R5498:Myom2 UTSW 8 15129142 missense probably benign 0.01
R5504:Myom2 UTSW 8 15128879 missense probably damaging 1.00
R5567:Myom2 UTSW 8 15102546 missense probably benign 0.01
R5743:Myom2 UTSW 8 15080914 missense possibly damaging 0.82
R5745:Myom2 UTSW 8 15122705 missense probably benign 0.01
R5844:Myom2 UTSW 8 15131182 critical splice donor site probably null
R5854:Myom2 UTSW 8 15108478 missense probably benign
R6141:Myom2 UTSW 8 15063903 missense probably damaging 1.00
R6209:Myom2 UTSW 8 15104173 missense possibly damaging 0.76
R6248:Myom2 UTSW 8 15098472 splice site probably null
R6378:Myom2 UTSW 8 15099356 missense probably benign 0.11
R6829:Myom2 UTSW 8 15122643 nonsense probably null
R6913:Myom2 UTSW 8 15065710 missense probably benign
R6957:Myom2 UTSW 8 15117741 missense probably null 0.42
R6958:Myom2 UTSW 8 15117741 missense probably null 0.42
R6960:Myom2 UTSW 8 15117741 missense probably null 0.42
R6961:Myom2 UTSW 8 15117741 missense probably null 0.42
R6962:Myom2 UTSW 8 15117741 missense probably null 0.42
R6999:Myom2 UTSW 8 15084531 missense probably benign 0.22
R7148:Myom2 UTSW 8 15084577 missense possibly damaging 0.72
R7210:Myom2 UTSW 8 15104114 missense probably damaging 1.00
R7298:Myom2 UTSW 8 15098411 missense probably damaging 1.00
R7535:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7573:Myom2 UTSW 8 15122450 missense probably damaging 1.00
R7590:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7690:Myom2 UTSW 8 15111717 critical splice acceptor site probably null
R7794:Myom2 UTSW 8 15083259 missense probably damaging 1.00
R7822:Myom2 UTSW 8 15108454 missense probably benign
R7948:Myom2 UTSW 8 15085306 missense probably benign 0.00
R8094:Myom2 UTSW 8 15069418 missense possibly damaging 0.94
R8268:Myom2 UTSW 8 15129157 missense probably damaging 1.00
R8292:Myom2 UTSW 8 15132888 missense probably benign 0.01
R8514:Myom2 UTSW 8 15125153 missense possibly damaging 0.65
R8539:Myom2 UTSW 8 15114254 missense probably benign 0.01
R8790:Myom2 UTSW 8 15119242 missense probably damaging 1.00
RF001:Myom2 UTSW 8 15081418 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AGAGAACAAATCTAGTATGGGTGTT -3'
(R):5'- AGGACAGCCTTGAATGCTATTCA -3'

Sequencing Primer
(F):5'- GGGTGTTTGAAATACTTCCTCCAAC -3'
(R):5'- ATGCTATTCAAGAAAAAGAGAGAGAG -3'
Posted On2019-10-07