Mutagenetix > Incidental Mutation

Incidental Mutation 'R7463:Dnmt1'

578563

Institutional Source

Beutler Lab

Gene Symbol

Dnmt1

Ensembl Gene

ENSMUSG00000004099

Gene Name

DNA methyltransferase (cytosine-5) 1

Synonyms

MTase, Dnmt1o, Cxxc9, MommeD2

MMRRC Submission

Accession Numbers

Genbank: NM_010066

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7463 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20907209-20959888 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 20912225 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 1147 (V1147M)

Ref Sequence

ENSEMBL: ENSMUSP00000004202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004202] [ENSMUST00000177754] [ENSMUST00000178110] [ENSMUST00000216540]

AlphaFold

P13864

PDB Structure

Crystal structure of mouse DNA methyltransferase 1 [X-RAY DIFFRACTION]
Crystal structure of mouse DNA methyltransferase 1 with AdoHcy [X-RAY DIFFRACTION]
Crystal structure of mouse DNA methyltransferase 1 with AdoMet [X-RAY DIFFRACTION]
Crystal structure of mouse DNMT1(650-1602) in complex with DNA [X-RAY DIFFRACTION]
Crystal structure of mouse DNMT1(731-1602) in the free state [X-RAY DIFFRACTION]
Structure of mouse DNMT1 (731-1602) bound to hemimethylated CpG DNA [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000004202
AA Change: V1147M

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000004202
Gene: ENSMUSG00000004099
AA Change: V1147M

Domain	Start	End	E-Value	Type
DMAP_binding	16	106	1.7e-13	SMART
low complexity region	121	143	N/A	INTRINSIC
low complexity region	156	166	N/A	INTRINSIC
low complexity region	180	194	N/A	INTRINSIC
low complexity region	273	290	N/A	INTRINSIC
low complexity region	306	328	N/A	INTRINSIC
Pfam:DNMT1-RFD	405	540	4.8e-46	PFAM
low complexity region	610	625	N/A	INTRINSIC
Pfam:zf-CXXC	648	694	2.7e-17	PFAM
low complexity region	701	711	N/A	INTRINSIC
low complexity region	719	731	N/A	INTRINSIC
BAH	758	884	4.62e-31	SMART
BAH	935	1103	1.79e-37	SMART
low complexity region	1110	1124	N/A	INTRINSIC
Pfam:DNA_methylase	1142	1596	1.3e-49	PFAM
low complexity region	1600	1619	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000177754
AA Change: V1028M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136982
Gene: ENSMUSG00000004099
AA Change: V1028M

Domain	Start	End	E-Value	Type
low complexity region	3	25	N/A	INTRINSIC
low complexity region	37	47	N/A	INTRINSIC
low complexity region	61	75	N/A	INTRINSIC
low complexity region	154	171	N/A	INTRINSIC
low complexity region	187	209	N/A	INTRINSIC
Pfam:DNMT1-RFD	286	421	3.4e-40	PFAM
low complexity region	491	506	N/A	INTRINSIC
Pfam:zf-CXXC	529	575	2.3e-17	PFAM
low complexity region	582	592	N/A	INTRINSIC
low complexity region	600	612	N/A	INTRINSIC
BAH	639	765	4.62e-31	SMART
BAH	816	984	1.79e-37	SMART
low complexity region	991	1005	N/A	INTRINSIC
Pfam:DNA_methylase	1023	1477	1.3e-49	PFAM
low complexity region	1481	1500	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000178110
AA Change: V1028M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136669
Gene: ENSMUSG00000004099
AA Change: V1028M

Domain	Start	End	E-Value	Type
low complexity region	3	25	N/A	INTRINSIC
low complexity region	38	48	N/A	INTRINSIC
low complexity region	62	76	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
Pfam:DNMT1-RFD	287	422	2.6e-40	PFAM
low complexity region	492	507	N/A	INTRINSIC
Pfam:zf-CXXC	530	576	4.7e-17	PFAM
low complexity region	583	593	N/A	INTRINSIC
low complexity region	601	613	N/A	INTRINSIC
BAH	640	766	4.62e-31	SMART
BAH	817	985	1.79e-37	SMART
low complexity region	992	1006	N/A	INTRINSIC
Pfam:DNA_methylase	1024	1478	8e-50	PFAM
low complexity region	1482	1501	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000216540
AA Change: V1029M

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)

Meta Mutation Damage Score

0.7424

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.7%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: This gene encodes a methyltransferase that preferentially methylates cytosines of CpG residues in hemimethylated DNA to generate fully methylated CpG base pairs during DNA replication. This enzyme plays roles in diverse cellular processes including cell cycle regulation, DNA repair, and telomere maintenance. The encoded protein is composed of an N-terminal domain with a nuclear localization sequence and replication fork-targeting domain, a DNA-binding CXXC domain, two bromo-adjacent homology domains, and a C-terminal catalytic domain. Mouse embryonic stem cells mutant for this gene are viable, but when introduced into the germ line, cause a recessive lethal phenotype with mutant embryos displaying stunted growth and developmental defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations causing partial or severe loss of function were homozygous lethal by embryonic day 9.5, with lack of appropriate genomic imprinting observed at several loci. [provided by MGI curators]

Allele List at MGI

All alleles(109) : Targeted, knock-out(5) Targeted, other(11) Gene trapped(92) Chemically induced(1)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	A	T	17: 46,323,772	V435E	probably damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adcy2	T	C	13: 68,730,280	D413G	probably damaging	Het
Adgrg6	T	A	10: 14,434,396	D727V	possibly damaging	Het
Aebp2	C	T	6: 140,637,726	Q309*	probably null	Het
Amy1	A	T	3: 113,569,884	C43*	probably null	Het
Bpifc	T	C	10: 85,979,334	E256G	probably benign	Het
Bysl	A	T	17: 47,602,471	S296T	probably benign	Het
Carmil3	C	T	14: 55,502,396	P980L	probably damaging	Het
Coch	T	A	12: 51,593,625	M1K	probably null	Het
Cpt2	A	T	4: 107,908,157	F137I	probably damaging	Het
Crem	T	C	18: 3,295,094	I112V	probably benign	Het
Cul9	A	G	17: 46,520,476		probably null	Het
Cyp3a41a	T	A	5: 145,713,564	I90F	probably damaging	Het
Cyp4f16	C	T	17: 32,550,787	A457V	possibly damaging	Het
Ddx6	A	G	9: 44,628,729	E318G	probably damaging	Het
Dip2b	A	G	15: 100,154,157	E213G	probably benign	Het
Dlx5	T	C	6: 6,878,316	H238R	probably damaging	Het
Dnaic2	A	C	11: 114,754,406	I556L	probably benign	Het
Egf	G	T	3: 129,740,015	Q59K	probably benign	Het
Ermp1	A	T	19: 29,646,262	Y109*	probably null	Het
Fer1l6	T	A	15: 58,573,601	Y573*	probably null	Het
Fmnl1	T	C	11: 103,193,128	L503P	probably damaging	Het
Gnptab	T	G	10: 88,431,389	I447M	probably damaging	Het
Hgf	G	A	5: 16,578,450	D253N	probably benign	Het
Hjurp	CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT	C	1: 88,266,277		probably benign	Het
Igf2r	T	C	17: 12,710,645	T958A	probably benign	Het
Kcnd2	T	A	6: 21,216,498	L67Q	probably damaging	Het
Kif5a	A	G	10: 127,243,724	V248A	probably damaging	Het
Krt33b	A	G	11: 100,029,563	I88T	probably damaging	Het
Lhx2	G	A	2: 38,351,846	E25K	possibly damaging	Het
Mex3d	C	T	10: 80,381,698	G562R		Het
Myom2	A	T	8: 15,117,679	Y1088F	probably null	Het
Ncapg	T	A	5: 45,694,092		probably null	Het
Nudc	A	C	4: 133,534,403	V190G	possibly damaging	Het
Obscn	G	T	11: 59,122,860	R1054S	probably benign	Het
Olfr1045	T	C	2: 86,197,838	M305V	probably benign	Het
Olfr1510	A	G	14: 52,410,711	W54R	probably benign	Het
Olfr651	T	C	7: 104,553,482	S188P	possibly damaging	Het
Olfr683	T	A	7: 105,143,937	M119L	probably benign	Het
Olfr710	A	T	7: 106,944,173	V276E	probably damaging	Het
Olfr979	A	G	9: 40,000,564	V221A	probably benign	Het
Pcdh10	A	T	3: 45,383,572	R891S	possibly damaging	Het
Pcdh15	C	T	10: 74,631,770	S1873L	possibly damaging	Het
Pcdh7	A	G	5: 57,720,998	K632E	probably benign	Het
Pcdhgb8	G	A	18: 37,763,427	A517T	probably damaging	Het
Ptgr2	A	T	12: 84,292,298		probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Racgap1	T	A	15: 99,642,958	T4S	probably benign	Het
Rb1cc1	A	G	1: 6,249,180	H941R	probably benign	Het
Reln	T	C	5: 22,103,435	H312R	probably damaging	Het
Rnf166	T	A	8: 122,467,987	H208L	probably damaging	Het
Theg	T	C	10: 79,576,715	E314G	probably damaging	Het
Timeless	T	C	10: 128,250,426	S999P	probably benign	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tor1aip1	A	T	1: 156,007,609	H349Q	possibly damaging	Het
Ttn	T	A	2: 76,920,460	E3415V	probably benign	Het
Vmn2r102	A	T	17: 19,676,624	N78Y	probably damaging	Het
Wdr11	A	T	7: 129,607,086	D427V	probably damaging	Het
Zer1	A	T	2: 30,113,437		probably benign	Het
Zfp516	T	A	18: 82,957,108	M477K	probably benign	Het

Other mutations in Dnmt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Dnmt1	APN	9	20910270	missense	possibly damaging	0.94
IGL01093:Dnmt1	APN	9	20909785	missense	possibly damaging	0.88
IGL01160:Dnmt1	APN	9	20917319	missense	possibly damaging	0.90
IGL01704:Dnmt1	APN	9	20910180	missense	probably damaging	1.00
IGL02105:Dnmt1	APN	9	20907882	missense	unknown
IGL02124:Dnmt1	APN	9	20908549	missense	probably damaging	1.00
IGL02188:Dnmt1	APN	9	20941738	nonsense	probably null
IGL02409:Dnmt1	APN	9	20926497	missense	probably benign	0.00
IGL02579:Dnmt1	APN	9	20918120	missense	possibly damaging	0.79
IGL02625:Dnmt1	APN	9	20927146	missense	probably benign	0.01
IGL02794:Dnmt1	APN	9	20936551	missense	probably benign
IGL02795:Dnmt1	APN	9	20927111	missense	probably benign	0.12
IGL02938:Dnmt1	APN	9	20941373	missense	probably benign	0.23
IGL03245:Dnmt1	APN	9	20915760	missense	probably damaging	0.99
IGL03303:Dnmt1	APN	9	20926710	missense	probably benign
Blankslate	UTSW	9	20912225	missense	possibly damaging	0.86
Midrash	UTSW	9	20909793	nonsense	probably null
Rashi	UTSW	9	20922112	missense	possibly damaging	0.94
B5639:Dnmt1	UTSW	9	20907968	splice site	probably benign
BB003:Dnmt1	UTSW	9	20907559	missense	unknown
BB013:Dnmt1	UTSW	9	20907559	missense	unknown
PIT4576001:Dnmt1	UTSW	9	20911775	missense	probably benign	0.28
R0071:Dnmt1	UTSW	9	20908620	missense	probably damaging	0.99
R0180:Dnmt1	UTSW	9	20908620	missense	probably damaging	0.99
R0368:Dnmt1	UTSW	9	20941757	missense	probably damaging	0.99
R0387:Dnmt1	UTSW	9	20918213	missense	probably damaging	1.00
R0529:Dnmt1	UTSW	9	20911550	missense	probably damaging	1.00
R0532:Dnmt1	UTSW	9	20918556	splice site	probably benign
R0612:Dnmt1	UTSW	9	20918193	missense	probably damaging	0.98
R1109:Dnmt1	UTSW	9	20922388	missense	probably damaging	1.00
R1298:Dnmt1	UTSW	9	20941456	missense	probably benign
R1345:Dnmt1	UTSW	9	20908518	missense	probably damaging	1.00
R1472:Dnmt1	UTSW	9	20932176	missense	probably benign	0.28
R1654:Dnmt1	UTSW	9	20936574	missense	possibly damaging	0.75
R1817:Dnmt1	UTSW	9	20927126	missense	probably benign
R1836:Dnmt1	UTSW	9	20918246	missense	probably damaging	1.00
R1957:Dnmt1	UTSW	9	20927146	missense	probably benign	0.01
R1958:Dnmt1	UTSW	9	20927146	missense	probably benign	0.01
R2097:Dnmt1	UTSW	9	20909788	missense	probably benign	0.00
R2145:Dnmt1	UTSW	9	20937155	splice site	probably benign
R2326:Dnmt1	UTSW	9	20924146	splice site	probably benign
R4199:Dnmt1	UTSW	9	20938118	missense	probably benign	0.00
R4456:Dnmt1	UTSW	9	20909842	missense	probably damaging	1.00
R4518:Dnmt1	UTSW	9	20911978	missense	probably benign	0.00
R4586:Dnmt1	UTSW	9	20926693	missense	probably benign	0.05
R4836:Dnmt1	UTSW	9	20908558	missense	probably damaging	1.00
R5014:Dnmt1	UTSW	9	20912254	missense	probably benign	0.07
R5338:Dnmt1	UTSW	9	20952719	missense	probably benign	0.44
R5385:Dnmt1	UTSW	9	20918480	missense	probably damaging	1.00
R5579:Dnmt1	UTSW	9	20920205	missense	probably damaging	1.00
R5645:Dnmt1	UTSW	9	20922147	missense	probably damaging	1.00
R5719:Dnmt1	UTSW	9	20912595	missense	possibly damaging	0.86
R5881:Dnmt1	UTSW	9	20952717	missense	probably damaging	0.97
R6039:Dnmt1	UTSW	9	20926420	intron	probably benign
R6039:Dnmt1	UTSW	9	20926420	intron	probably benign
R6143:Dnmt1	UTSW	9	20927134	missense	probably benign	0.30
R6342:Dnmt1	UTSW	9	20909793	nonsense	probably null
R6374:Dnmt1	UTSW	9	20924045	missense	possibly damaging	0.73
R6953:Dnmt1	UTSW	9	20918526	missense	probably benign
R6990:Dnmt1	UTSW	9	20915814	nonsense	probably null
R7089:Dnmt1	UTSW	9	20908489	missense	probably damaging	0.99
R7522:Dnmt1	UTSW	9	20920202	missense	probably damaging	0.99
R7695:Dnmt1	UTSW	9	20913985	missense	probably null	1.00
R7785:Dnmt1	UTSW	9	20922049	missense	probably damaging	0.98
R7926:Dnmt1	UTSW	9	20907559	missense	unknown
R8037:Dnmt1	UTSW	9	20941564	missense	probably damaging	0.99
R8038:Dnmt1	UTSW	9	20941564	missense	probably damaging	0.99
R8424:Dnmt1	UTSW	9	20918540	missense	probably benign	0.07
R8692:Dnmt1	UTSW	9	20941781	missense	probably damaging	1.00
R9016:Dnmt1	UTSW	9	20936559	missense	possibly damaging	0.67
R9101:Dnmt1	UTSW	9	20941543	missense	probably damaging	1.00
R9200:Dnmt1	UTSW	9	20908600	missense	probably benign	0.00
R9248:Dnmt1	UTSW	9	20922112	missense	possibly damaging	0.94
R9317:Dnmt1	UTSW	9	20918279	missense	probably damaging	0.99
R9352:Dnmt1	UTSW	9	20929088	missense	probably benign	0.00
R9438:Dnmt1	UTSW	9	20915894	missense	probably benign
RF003:Dnmt1	UTSW	9	20910131	nonsense	probably null
RF004:Dnmt1	UTSW	9	20910127	nonsense	probably null
RF011:Dnmt1	UTSW	9	20910128	nonsense	probably null
RF011:Dnmt1	UTSW	9	20910144	nonsense	probably null
RF015:Dnmt1	UTSW	9	20910124	nonsense	probably null
RF015:Dnmt1	UTSW	9	20910129	nonsense	probably null
RF017:Dnmt1	UTSW	9	20910126	nonsense	probably null
RF023:Dnmt1	UTSW	9	20910131	nonsense	probably null
RF024:Dnmt1	UTSW	9	20910130	nonsense	probably null
RF024:Dnmt1	UTSW	9	20910138	small insertion	probably benign
RF025:Dnmt1	UTSW	9	20910120	nonsense	probably null
RF025:Dnmt1	UTSW	9	20910135	nonsense	probably null
RF029:Dnmt1	UTSW	9	20910123	nonsense	probably null
RF034:Dnmt1	UTSW	9	20910120	nonsense	probably null
RF037:Dnmt1	UTSW	9	20910119	critical splice donor site	probably benign
RF037:Dnmt1	UTSW	9	20910133	nonsense	probably null
RF037:Dnmt1	UTSW	9	20910141	nonsense	probably null
RF042:Dnmt1	UTSW	9	20910119	nonsense	probably null
RF045:Dnmt1	UTSW	9	20910129	nonsense	probably null
RF045:Dnmt1	UTSW	9	20910137	small insertion	probably benign
RF047:Dnmt1	UTSW	9	20910125	nonsense	probably null
RF048:Dnmt1	UTSW	9	20910126	nonsense	probably null
RF054:Dnmt1	UTSW	9	20910139	nonsense	probably null
RF055:Dnmt1	UTSW	9	20910128	nonsense	probably null
RF055:Dnmt1	UTSW	9	20910135	nonsense	probably null
RF055:Dnmt1	UTSW	9	20910136	small insertion	probably benign
RF059:Dnmt1	UTSW	9	20910138	small insertion	probably benign
RF059:Dnmt1	UTSW	9	20910139	nonsense	probably null
RF060:Dnmt1	UTSW	9	20910142	nonsense	probably null
RF061:Dnmt1	UTSW	9	20910130	nonsense	probably null
X0026:Dnmt1	UTSW	9	20913914	missense	probably damaging	1.00
Z1176:Dnmt1	UTSW	9	20915863	missense	probably damaging	0.99
Z1176:Dnmt1	UTSW	9	20926554	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTTTCCGAGATGCCTGGTAGAC -3'
(R):5'- GCTCTAGGTCACATAGCATGG -3'

Sequencing Primer
(F):5'- GCCAGACGAGTGCCATTTTAAATC -3'
(R):5'- CTCTAGGTCACATAGCATGGCAGAG -3'

Posted On

2019-10-07