Mutagenetix > Incidental Mutation

Incidental Mutation 'R7463:Olfr979'

578564

Institutional Source

Beutler Lab

Gene Symbol

Olfr979

Ensembl Gene

ENSMUSG00000059473

Gene Name

olfactory receptor 979

Synonyms

MOR223-1, GA_x6K02T2PVTD-33699706-33698771

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R7463 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

39998003-40003465 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 40000564 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 221 (V221A)

Ref Sequence

ENSEMBL: ENSMUSP00000148903 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080835] [ENSMUST00000215523] [ENSMUST00000216463]

AlphaFold

Q8VH10

Predicted Effect

probably benign
Transcript: ENSMUST00000080835
AA Change: V221A

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000079648
Gene: ENSMUSG00000059473
AA Change: V221A

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	304	7.9e-58	PFAM
Pfam:7tm_1	39	287	5.2e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000215523
AA Change: V221A

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

probably benign
Transcript: ENSMUST00000216463

Meta Mutation Damage Score

0.2199

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.7%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	A	T	17: 46,323,772	V435E	probably damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adcy2	T	C	13: 68,730,280	D413G	probably damaging	Het
Adgrg6	T	A	10: 14,434,396	D727V	possibly damaging	Het
Aebp2	C	T	6: 140,637,726	Q309*	probably null	Het
Amy1	A	T	3: 113,569,884	C43*	probably null	Het
Bpifc	T	C	10: 85,979,334	E256G	probably benign	Het
Bysl	A	T	17: 47,602,471	S296T	probably benign	Het
Carmil3	C	T	14: 55,502,396	P980L	probably damaging	Het
Coch	T	A	12: 51,593,625	M1K	probably null	Het
Cpt2	A	T	4: 107,908,157	F137I	probably damaging	Het
Crem	T	C	18: 3,295,094	I112V	probably benign	Het
Cul9	A	G	17: 46,520,476		probably null	Het
Cyp3a41a	T	A	5: 145,713,564	I90F	probably damaging	Het
Cyp4f16	C	T	17: 32,550,787	A457V	possibly damaging	Het
Ddx6	A	G	9: 44,628,729	E318G	probably damaging	Het
Dip2b	A	G	15: 100,154,157	E213G	probably benign	Het
Dlx5	T	C	6: 6,878,316	H238R	probably damaging	Het
Dnaic2	A	C	11: 114,754,406	I556L	probably benign	Het
Dnmt1	C	T	9: 20,912,225	V1147M	possibly damaging	Het
Egf	G	T	3: 129,740,015	Q59K	probably benign	Het
Ermp1	A	T	19: 29,646,262	Y109*	probably null	Het
Fer1l6	T	A	15: 58,573,601	Y573*	probably null	Het
Fmnl1	T	C	11: 103,193,128	L503P	probably damaging	Het
Gnptab	T	G	10: 88,431,389	I447M	probably damaging	Het
Hgf	G	A	5: 16,578,450	D253N	probably benign	Het
Hjurp	CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT	C	1: 88,266,277		probably benign	Het
Igf2r	T	C	17: 12,710,645	T958A	probably benign	Het
Kcnd2	T	A	6: 21,216,498	L67Q	probably damaging	Het
Kif5a	A	G	10: 127,243,724	V248A	probably damaging	Het
Krt33b	A	G	11: 100,029,563	I88T	probably damaging	Het
Lhx2	G	A	2: 38,351,846	E25K	possibly damaging	Het
Mex3d	C	T	10: 80,381,698	G562R		Het
Myom2	A	T	8: 15,117,679	Y1088F	probably null	Het
Ncapg	T	A	5: 45,694,092		probably null	Het
Nudc	A	C	4: 133,534,403	V190G	possibly damaging	Het
Obscn	G	T	11: 59,122,860	R1054S	probably benign	Het
Olfr1045	T	C	2: 86,197,838	M305V	probably benign	Het
Olfr1510	A	G	14: 52,410,711	W54R	probably benign	Het
Olfr651	T	C	7: 104,553,482	S188P	possibly damaging	Het
Olfr683	T	A	7: 105,143,937	M119L	probably benign	Het
Olfr710	A	T	7: 106,944,173	V276E	probably damaging	Het
Pcdh10	A	T	3: 45,383,572	R891S	possibly damaging	Het
Pcdh15	C	T	10: 74,631,770	S1873L	possibly damaging	Het
Pcdh7	A	G	5: 57,720,998	K632E	probably benign	Het
Pcdhgb8	G	A	18: 37,763,427	A517T	probably damaging	Het
Ptgr2	A	T	12: 84,292,298		probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Racgap1	T	A	15: 99,642,958	T4S	probably benign	Het
Rb1cc1	A	G	1: 6,249,180	H941R	probably benign	Het
Reln	T	C	5: 22,103,435	H312R	probably damaging	Het
Rnf166	T	A	8: 122,467,987	H208L	probably damaging	Het
Theg	T	C	10: 79,576,715	E314G	probably damaging	Het
Timeless	T	C	10: 128,250,426	S999P	probably benign	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tor1aip1	A	T	1: 156,007,609	H349Q	possibly damaging	Het
Ttn	T	A	2: 76,920,460	E3415V	probably benign	Het
Vmn2r102	A	T	17: 19,676,624	N78Y	probably damaging	Het
Wdr11	A	T	7: 129,607,086	D427V	probably damaging	Het
Zer1	A	T	2: 30,113,437		probably benign	Het
Zfp516	T	A	18: 82,957,108	M477K	probably benign	Het

Other mutations in Olfr979

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02718:Olfr979	APN	9	40000886	missense	probably damaging	1.00
IGL02939:Olfr979	APN	9	40000898	missense	probably benign	0.26
IGL02991:Olfr979	UTSW	9	40000402	missense	probably damaging	1.00
R1388:Olfr979	UTSW	9	40000652	missense	probably damaging	0.99
R1572:Olfr979	UTSW	9	40001194	missense	probably benign	0.35
R2089:Olfr979	UTSW	9	40001204	missense	probably benign	0.01
R2091:Olfr979	UTSW	9	40001204	missense	probably benign	0.01
R2091:Olfr979	UTSW	9	40001204	missense	probably benign	0.01
R2179:Olfr979	UTSW	9	40000924	missense	probably benign	0.44
R3424:Olfr979	UTSW	9	40000534	missense	probably damaging	0.97
R3964:Olfr979	UTSW	9	40000471	missense	possibly damaging	0.95
R3965:Olfr979	UTSW	9	40000471	missense	possibly damaging	0.95
R4111:Olfr979	UTSW	9	40000898	nonsense	probably null
R4537:Olfr979	UTSW	9	40000320	missense	probably benign	0.01
R4737:Olfr979	UTSW	9	40000422	missense	probably damaging	0.96
R4926:Olfr979	UTSW	9	40001023	splice site	probably null
R5303:Olfr979	UTSW	9	40000588	missense	probably damaging	1.00
R5587:Olfr979	UTSW	9	40000621	missense	possibly damaging	0.90
R6387:Olfr979	UTSW	9	40000852	missense	probably damaging	0.99
R6394:Olfr979	UTSW	9	40000705	missense	probably benign	0.04
R6765:Olfr979	UTSW	9	40001197	missense	probably damaging	1.00
R7312:Olfr979	UTSW	9	40000810	missense	probably benign	0.22
R7486:Olfr979	UTSW	9	40000885	missense	probably benign	0.39
R7581:Olfr979	UTSW	9	40000422	missense	probably damaging	0.96
R8364:Olfr979	UTSW	9	40000364	missense	probably benign	0.22
R8414:Olfr979	UTSW	9	40000945	missense	probably benign	0.19
R9049:Olfr979	UTSW	9	40000623	missense	possibly damaging	0.56
R9567:Olfr979	UTSW	9	40001071	missense	possibly damaging	0.95
R9632:Olfr979	UTSW	9	40000876	missense	probably damaging	1.00
R9710:Olfr979	UTSW	9	40000876	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGGGTGTACACAACAGGG -3'
(R):5'- GTCCAGACTACATTGACCTTCC -3'

Sequencing Primer
(F):5'- TTGAGTAGGGGTGTCAACAC -3'
(R):5'- AGACTACATTGACCTTCCGTTTG -3'

Posted On

2019-10-07