Incidental Mutation 'R7463:Spmap2'
ID 578568
Institutional Source Beutler Lab
Gene Symbol Spmap2
Ensembl Gene ENSMUSG00000020317
Gene Name sperm microtubule associated protein 2
Synonyms Theg
MMRRC Submission 045537-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7463 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 79412311-79422970 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79412549 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 314 (E314G)
Ref Sequence ENSEMBL: ENSMUSP00000020566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020566] [ENSMUST00000077433]
AlphaFold Q9JMB1
Predicted Effect probably damaging
Transcript: ENSMUST00000020566
AA Change: E314G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020566
Gene: ENSMUSG00000020317
AA Change: E314G

DomainStartEndE-ValueType
THEG 9 28 1.68e2 SMART
low complexity region 58 73 N/A INTRINSIC
THEG 110 129 2.22e-2 SMART
THEG 176 195 4.69e-1 SMART
THEG 214 233 9.16e-4 SMART
THEG 250 269 7.22e-2 SMART
THEG 282 301 2.31e0 SMART
THEG 318 337 4.45e-2 SMART
THEG 352 371 1.96e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077433
AA Change: E290G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076647
Gene: ENSMUSG00000020317
AA Change: E290G

DomainStartEndE-ValueType
THEG 9 28 6.2e-1 SMART
low complexity region 58 73 N/A INTRINSIC
THEG 110 129 7.8e-5 SMART
THEG 152 171 1.7e-3 SMART
THEG 190 209 3.3e-6 SMART
THEG 226 245 2.5e-4 SMART
THEG 258 277 8.3e-3 SMART
THEG 294 313 1.6e-4 SMART
THEG 328 347 7e-6 SMART
Meta Mutation Damage Score 0.1733 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in the nucleus of haploid male germ cells. The orthologous gene in mice encodes a protein that may play a role in protein assembly through interactions with T-complex protein 1 subunit epsilon. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Males homozygotes for a transgenic insertional mutation are sterile due to a block in spermiogenesis. Testis weights are reduced, and mutants exhibit multiple abnormalities in elongated spermatids in the seminiferous tubule lumen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,634,698 (GRCm39) V435E probably damaging Het
Acta2 G A 19: 34,229,931 (GRCm39) T8I probably benign Het
Adcy2 T C 13: 68,878,399 (GRCm39) D413G probably damaging Het
Adgrg6 T A 10: 14,310,140 (GRCm39) D727V possibly damaging Het
Aebp2 C T 6: 140,583,452 (GRCm39) Q309* probably null Het
Amy1 A T 3: 113,363,533 (GRCm39) C43* probably null Het
Bpifc T C 10: 85,815,198 (GRCm39) E256G probably benign Het
Bysl A T 17: 47,913,396 (GRCm39) S296T probably benign Het
Carmil3 C T 14: 55,739,853 (GRCm39) P980L probably damaging Het
Coch T A 12: 51,640,408 (GRCm39) M1K probably null Het
Cpt2 A T 4: 107,765,354 (GRCm39) F137I probably damaging Het
Crem T C 18: 3,295,094 (GRCm39) I112V probably benign Het
Cul9 A G 17: 46,831,402 (GRCm39) probably null Het
Cyp3a41a T A 5: 145,650,374 (GRCm39) I90F probably damaging Het
Cyp4f16 C T 17: 32,769,761 (GRCm39) A457V possibly damaging Het
Ddx6 A G 9: 44,540,026 (GRCm39) E318G probably damaging Het
Dip2b A G 15: 100,052,038 (GRCm39) E213G probably benign Het
Dlx5 T C 6: 6,878,316 (GRCm39) H238R probably damaging Het
Dnai2 A C 11: 114,645,232 (GRCm39) I556L probably benign Het
Dnmt1 C T 9: 20,823,521 (GRCm39) V1147M possibly damaging Het
Egf G T 3: 129,533,664 (GRCm39) Q59K probably benign Het
Ermp1 A T 19: 29,623,662 (GRCm39) Y109* probably null Het
Fer1l6 T A 15: 58,445,450 (GRCm39) Y573* probably null Het
Fmnl1 T C 11: 103,083,954 (GRCm39) L503P probably damaging Het
Gnptab T G 10: 88,267,251 (GRCm39) I447M probably damaging Het
Hgf G A 5: 16,783,448 (GRCm39) D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Igf2r T C 17: 12,929,532 (GRCm39) T958A probably benign Het
Kcnd2 T A 6: 21,216,497 (GRCm39) L67Q probably damaging Het
Kif5a A G 10: 127,079,593 (GRCm39) V248A probably damaging Het
Krt33b A G 11: 99,920,389 (GRCm39) I88T probably damaging Het
Lhx2 G A 2: 38,241,858 (GRCm39) E25K possibly damaging Het
Mex3d C T 10: 80,217,532 (GRCm39) G562R Het
Myom2 A T 8: 15,167,679 (GRCm39) Y1088F probably null Het
Ncapg T A 5: 45,851,434 (GRCm39) probably null Het
Nudc A C 4: 133,261,714 (GRCm39) V190G possibly damaging Het
Obscn G T 11: 59,013,686 (GRCm39) R1054S probably benign Het
Or10g1 A G 14: 52,648,168 (GRCm39) W54R probably benign Het
Or10g9 A G 9: 39,911,860 (GRCm39) V221A probably benign Het
Or2d4 A T 7: 106,543,380 (GRCm39) V276E probably damaging Het
Or52h9 T C 7: 104,202,689 (GRCm39) S188P possibly damaging Het
Or56a5 T A 7: 104,793,144 (GRCm39) M119L probably benign Het
Or8j3 T C 2: 86,028,182 (GRCm39) M305V probably benign Het
Pcdh10 A T 3: 45,338,007 (GRCm39) R891S possibly damaging Het
Pcdh15 C T 10: 74,467,602 (GRCm39) S1873L possibly damaging Het
Pcdh7 A G 5: 57,878,340 (GRCm39) K632E probably benign Het
Pcdhgb8 G A 18: 37,896,480 (GRCm39) A517T probably damaging Het
Ptgr2 A T 12: 84,339,072 (GRCm39) probably benign Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Racgap1 T A 15: 99,540,839 (GRCm39) T4S probably benign Het
Rb1cc1 A G 1: 6,319,404 (GRCm39) H941R probably benign Het
Reln T C 5: 22,308,433 (GRCm39) H312R probably damaging Het
Rnf166 T A 8: 123,194,726 (GRCm39) H208L probably damaging Het
Timeless T C 10: 128,086,295 (GRCm39) S999P probably benign Het
Tmem94 G T 11: 115,677,082 (GRCm39) R118L possibly damaging Het
Tor1aip1 A T 1: 155,883,355 (GRCm39) H349Q possibly damaging Het
Ttn T A 2: 76,750,804 (GRCm39) E3415V probably benign Het
Vmn2r102 A T 17: 19,896,886 (GRCm39) N78Y probably damaging Het
Wdr11 A T 7: 129,208,810 (GRCm39) D427V probably damaging Het
Zer1 A T 2: 30,003,449 (GRCm39) probably benign Het
Zfp516 T A 18: 82,975,233 (GRCm39) M477K probably benign Het
Other mutations in Spmap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Spmap2 APN 10 79,412,433 (GRCm39) missense probably damaging 0.99
IGL02013:Spmap2 APN 10 79,415,769 (GRCm39) splice site probably null
R0087:Spmap2 UTSW 10 79,421,785 (GRCm39) nonsense probably null
R1035:Spmap2 UTSW 10 79,419,684 (GRCm39) missense probably damaging 1.00
R4133:Spmap2 UTSW 10 79,415,884 (GRCm39) missense probably damaging 0.97
R5960:Spmap2 UTSW 10 79,421,765 (GRCm39) missense possibly damaging 0.76
R5971:Spmap2 UTSW 10 79,420,589 (GRCm39) missense probably damaging 1.00
R6067:Spmap2 UTSW 10 79,420,589 (GRCm39) missense probably damaging 1.00
R6138:Spmap2 UTSW 10 79,420,589 (GRCm39) missense probably damaging 1.00
R6357:Spmap2 UTSW 10 79,422,789 (GRCm39) missense probably benign 0.28
R7046:Spmap2 UTSW 10 79,422,796 (GRCm39) missense probably benign 0.35
R7117:Spmap2 UTSW 10 79,420,741 (GRCm39) splice site probably null
R8441:Spmap2 UTSW 10 79,412,510 (GRCm39) missense probably damaging 1.00
R8739:Spmap2 UTSW 10 79,419,581 (GRCm39) missense possibly damaging 0.80
R8883:Spmap2 UTSW 10 79,412,474 (GRCm39) missense probably benign 0.10
R9060:Spmap2 UTSW 10 79,420,571 (GRCm39) missense probably damaging 1.00
U15987:Spmap2 UTSW 10 79,420,589 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGGATGCACTTGGTGTTTAC -3'
(R):5'- TTGTGCTCCGGATTTGACAC -3'

Sequencing Primer
(F):5'- AGAAGGCTTGGTTGTCACAC -3'
(R):5'- CTCCGGATTTGACACTGTGG -3'
Posted On 2019-10-07