Incidental Mutation 'R7463:Mex3d'
ID578569
Institutional Source Beutler Lab
Gene Symbol Mex3d
Ensembl Gene ENSMUSG00000048696
Gene Namemex3 RNA binding family member D
SynonymsRkhd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R7463 (G1)
Quality Score131.008
Status Validated
Chromosome10
Chromosomal Location80380355-80387659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80381698 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 562 (G562R)
Ref Sequence ENSEMBL: ENSMUSP00000100987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105350]
Predicted Effect
SMART Domains Protein: ENSMUSP00000100987
Gene: ENSMUSG00000048696
AA Change: G562R

DomainStartEndE-ValueType
internal_repeat_2 3 25 3.12e-8 PROSPERO
internal_repeat_1 5 34 7.48e-13 PROSPERO
internal_repeat_1 41 70 7.48e-13 PROSPERO
internal_repeat_2 51 73 3.12e-8 PROSPERO
low complexity region 78 94 N/A INTRINSIC
KH 125 193 6.8e-10 SMART
KH 220 287 4.45e-14 SMART
low complexity region 356 388 N/A INTRINSIC
low complexity region 463 478 N/A INTRINSIC
low complexity region 499 524 N/A INTRINSIC
low complexity region 535 557 N/A INTRINSIC
RING 560 599 7.34e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123141
AA Change: G97R

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000115410
Gene: ENSMUSG00000048696
AA Change: G97R

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
low complexity region 106 121 N/A INTRINSIC
low complexity region 142 167 N/A INTRINSIC
low complexity region 178 200 N/A INTRINSIC
RING 203 242 7.34e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,772 V435E probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy2 T C 13: 68,730,280 D413G probably damaging Het
Adgrg6 T A 10: 14,434,396 D727V possibly damaging Het
Aebp2 C T 6: 140,637,726 Q309* probably null Het
Amy1 A T 3: 113,569,884 C43* probably null Het
Bpifc T C 10: 85,979,334 E256G probably benign Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Carmil3 C T 14: 55,502,396 P980L probably damaging Het
Coch T A 12: 51,593,625 M1K probably null Het
Cpt2 A T 4: 107,908,157 F137I probably damaging Het
Crem T C 18: 3,295,094 I112V probably benign Het
Cul9 A G 17: 46,520,476 probably null Het
Cyp3a41a T A 5: 145,713,564 I90F probably damaging Het
Cyp4f16 C T 17: 32,550,787 A457V possibly damaging Het
Ddx6 A G 9: 44,628,729 E318G probably damaging Het
Dip2b A G 15: 100,154,157 E213G probably benign Het
Dlx5 T C 6: 6,878,316 H238R probably damaging Het
Dnaic2 A C 11: 114,754,406 I556L probably benign Het
Dnmt1 C T 9: 20,912,225 V1147M possibly damaging Het
Egf G T 3: 129,740,015 Q59K probably benign Het
Ermp1 A T 19: 29,646,262 Y109* probably null Het
Fer1l6 T A 15: 58,573,601 Y573* probably null Het
Fmnl1 T C 11: 103,193,128 L503P probably damaging Het
Gnptab T G 10: 88,431,389 I447M probably damaging Het
Hgf G A 5: 16,578,450 D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Igf2r T C 17: 12,710,645 T958A probably benign Het
Kcnd2 T A 6: 21,216,498 L67Q probably damaging Het
Kif5a A G 10: 127,243,724 V248A probably damaging Het
Krt33b A G 11: 100,029,563 I88T probably damaging Het
Lhx2 G A 2: 38,351,846 E25K possibly damaging Het
Myom2 A T 8: 15,117,679 Y1088F probably null Het
Ncapg T A 5: 45,694,092 probably null Het
Nudc A C 4: 133,534,403 V190G possibly damaging Het
Obscn G T 11: 59,122,860 R1054S probably benign Het
Olfr1045 T C 2: 86,197,838 M305V probably benign Het
Olfr1510 A G 14: 52,410,711 W54R probably benign Het
Olfr651 T C 7: 104,553,482 S188P possibly damaging Het
Olfr683 T A 7: 105,143,937 M119L probably benign Het
Olfr710 A T 7: 106,944,173 V276E probably damaging Het
Olfr979 A G 9: 40,000,564 V221A probably benign Het
Pcdh10 A T 3: 45,383,572 R891S possibly damaging Het
Pcdh15 C T 10: 74,631,770 S1873L possibly damaging Het
Pcdh7 A G 5: 57,720,998 K632E probably benign Het
Pcdhgb8 G A 18: 37,763,427 A517T probably damaging Het
Ptgr2 A T 12: 84,292,298 probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Racgap1 T A 15: 99,642,958 T4S probably benign Het
Rb1cc1 A G 1: 6,249,180 H941R probably benign Het
Reln T C 5: 22,103,435 H312R probably damaging Het
Rnf166 T A 8: 122,467,987 H208L probably damaging Het
Theg T C 10: 79,576,715 E314G probably damaging Het
Timeless T C 10: 128,250,426 S999P probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tor1aip1 A T 1: 156,007,609 H349Q possibly damaging Het
Ttn T A 2: 76,920,460 E3415V probably benign Het
Vmn2r102 A T 17: 19,676,624 N78Y probably damaging Het
Wdr11 A T 7: 129,607,086 D427V probably damaging Het
Zer1 A T 2: 30,113,437 probably benign Het
Zfp516 T A 18: 82,957,108 M477K probably benign Het
Other mutations in Mex3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01554:Mex3d APN 10 80382035 missense possibly damaging 0.49
R0316:Mex3d UTSW 10 80381671 missense probably damaging 0.97
R0401:Mex3d UTSW 10 80386894 missense probably benign 0.33
R0734:Mex3d UTSW 10 80381532 missense possibly damaging 0.55
R0894:Mex3d UTSW 10 80381542 missense probably benign 0.04
R1452:Mex3d UTSW 10 80381520 missense probably damaging 0.99
R1764:Mex3d UTSW 10 80386936 missense probably benign 0.15
R1795:Mex3d UTSW 10 80381542 missense probably benign 0.04
R4801:Mex3d UTSW 10 80386954 missense possibly damaging 0.77
R4802:Mex3d UTSW 10 80386954 missense possibly damaging 0.77
R5632:Mex3d UTSW 10 80382594 missense probably damaging 1.00
R5701:Mex3d UTSW 10 80381545 missense probably benign 0.00
R5964:Mex3d UTSW 10 80382587 missense probably damaging 1.00
R6133:Mex3d UTSW 10 80386786 missense probably damaging 0.99
R6414:Mex3d UTSW 10 80381371 missense unknown
R6938:Mex3d UTSW 10 80382240 missense possibly damaging 0.61
R7154:Mex3d UTSW 10 80386750 missense
R7241:Mex3d UTSW 10 80387257 missense
Z1176:Mex3d UTSW 10 80386713 missense
Z1177:Mex3d UTSW 10 80381350 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGCCTCACCTTCAGAACAC -3'
(R):5'- CCAGAGGACTGTGACTTTGG -3'

Sequencing Primer
(F):5'- CTTCCGAGGGGACAGTGTCTAG -3'
(R):5'- GTTTTGACTTCCTGGCGCTAGAC -3'
Posted On2019-10-07