Incidental Mutation 'R7463:Kif5a'
ID578572
Institutional Source Beutler Lab
Gene Symbol Kif5a
Ensembl Gene ENSMUSG00000074657
Gene Namekinesin family member 5A
SynonymsKhc, Kns, Kif5, D10Bwg0738e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7463 (G1)
Quality Score215.009
Status Validated
Chromosome10
Chromosomal Location127225696-127263348 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127243724 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 248 (V248A)
Ref Sequence ENSEMBL: ENSMUSP00000096775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099172] [ENSMUST00000217895] [ENSMUST00000218298]
Predicted Effect probably damaging
Transcript: ENSMUST00000099172
AA Change: V248A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096775
Gene: ENSMUSG00000074657
AA Change: V248A

DomainStartEndE-ValueType
KISc 7 335 7.38e-173 SMART
low complexity region 340 362 N/A INTRINSIC
coiled coil region 408 539 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
coiled coil region 632 800 N/A INTRINSIC
coiled coil region 822 905 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217895
AA Change: V248A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000218298
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of proteins. Members of this family are part of a multisubunit complex that functions as a microtubule motor in intracellular organelle transport. Mutations in this gene cause autosomal dominant spastic paraplegia 10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes complete neonatal lethality. Homozygotes delivered by caesarian section are alive at E18.5 but usually die within minutes after birth, exhibiting an abnormal breathing pattern, atelectasis, cyanosis, and abnormal motor neuron morphology in the spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,772 V435E probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy2 T C 13: 68,730,280 D413G probably damaging Het
Adgrg6 T A 10: 14,434,396 D727V possibly damaging Het
Aebp2 C T 6: 140,637,726 Q309* probably null Het
Amy1 A T 3: 113,569,884 C43* probably null Het
Bpifc T C 10: 85,979,334 E256G probably benign Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Carmil3 C T 14: 55,502,396 P980L probably damaging Het
Coch T A 12: 51,593,625 M1K probably null Het
Cpt2 A T 4: 107,908,157 F137I probably damaging Het
Crem T C 18: 3,295,094 I112V probably benign Het
Cul9 A G 17: 46,520,476 probably null Het
Cyp3a41a T A 5: 145,713,564 I90F probably damaging Het
Cyp4f16 C T 17: 32,550,787 A457V possibly damaging Het
Ddx6 A G 9: 44,628,729 E318G probably damaging Het
Dip2b A G 15: 100,154,157 E213G probably benign Het
Dlx5 T C 6: 6,878,316 H238R probably damaging Het
Dnaic2 A C 11: 114,754,406 I556L probably benign Het
Dnmt1 C T 9: 20,912,225 V1147M possibly damaging Het
Egf G T 3: 129,740,015 Q59K probably benign Het
Ermp1 A T 19: 29,646,262 Y109* probably null Het
Fer1l6 T A 15: 58,573,601 Y573* probably null Het
Fmnl1 T C 11: 103,193,128 L503P probably damaging Het
Gnptab T G 10: 88,431,389 I447M probably damaging Het
Hgf G A 5: 16,578,450 D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Igf2r T C 17: 12,710,645 T958A probably benign Het
Kcnd2 T A 6: 21,216,498 L67Q probably damaging Het
Krt33b A G 11: 100,029,563 I88T probably damaging Het
Lhx2 G A 2: 38,351,846 E25K possibly damaging Het
Mex3d C T 10: 80,381,698 G562R Het
Myom2 A T 8: 15,117,679 Y1088F probably null Het
Ncapg T A 5: 45,694,092 probably null Het
Nudc A C 4: 133,534,403 V190G possibly damaging Het
Obscn G T 11: 59,122,860 R1054S probably benign Het
Olfr1045 T C 2: 86,197,838 M305V probably benign Het
Olfr1510 A G 14: 52,410,711 W54R probably benign Het
Olfr651 T C 7: 104,553,482 S188P possibly damaging Het
Olfr683 T A 7: 105,143,937 M119L probably benign Het
Olfr710 A T 7: 106,944,173 V276E probably damaging Het
Olfr979 A G 9: 40,000,564 V221A probably benign Het
Pcdh10 A T 3: 45,383,572 R891S possibly damaging Het
Pcdh15 C T 10: 74,631,770 S1873L possibly damaging Het
Pcdh7 A G 5: 57,720,998 K632E probably benign Het
Pcdhgb8 G A 18: 37,763,427 A517T probably damaging Het
Ptgr2 A T 12: 84,292,298 probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Racgap1 T A 15: 99,642,958 T4S probably benign Het
Rb1cc1 A G 1: 6,249,180 H941R probably benign Het
Reln T C 5: 22,103,435 H312R probably damaging Het
Rnf166 T A 8: 122,467,987 H208L probably damaging Het
Theg T C 10: 79,576,715 E314G probably damaging Het
Timeless T C 10: 128,250,426 S999P probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tor1aip1 A T 1: 156,007,609 H349Q possibly damaging Het
Ttn T A 2: 76,920,460 E3415V probably benign Het
Vmn2r102 A T 17: 19,676,624 N78Y probably damaging Het
Wdr11 A T 7: 129,607,086 D427V probably damaging Het
Zer1 A T 2: 30,113,437 probably benign Het
Zfp516 T A 18: 82,957,108 M477K probably benign Het
Other mutations in Kif5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Kif5a APN 10 127239196 missense probably benign
IGL01405:Kif5a APN 10 127245990 missense probably damaging 1.00
IGL01637:Kif5a APN 10 127245368 missense possibly damaging 0.94
IGL01894:Kif5a APN 10 127262779 missense probably benign 0.04
IGL01978:Kif5a APN 10 127245739 missense probably benign
IGL02039:Kif5a APN 10 127233867 missense possibly damaging 0.95
IGL02052:Kif5a APN 10 127243499 missense probably damaging 1.00
IGL02336:Kif5a APN 10 127242696 missense possibly damaging 0.87
IGL02352:Kif5a APN 10 127243501 missense probably damaging 1.00
IGL02359:Kif5a APN 10 127243501 missense probably damaging 1.00
IGL02834:Kif5a APN 10 127245756 missense probably benign 0.00
IGL03101:Kif5a APN 10 127235609 unclassified probably benign
brittany UTSW 10 127248254 missense probably damaging 1.00
spaniel UTSW 10 127230578 missense probably benign 0.00
R0463:Kif5a UTSW 10 127235652 missense probably benign 0.00
R0790:Kif5a UTSW 10 127246009 intron probably benign
R1070:Kif5a UTSW 10 127245406 missense probably benign 0.00
R1404:Kif5a UTSW 10 127245442 missense probably benign 0.12
R1404:Kif5a UTSW 10 127245442 missense probably benign 0.12
R1502:Kif5a UTSW 10 127245441 missense probably damaging 1.00
R1812:Kif5a UTSW 10 127242010 missense probably benign 0.03
R1837:Kif5a UTSW 10 127236815 nonsense probably null
R1838:Kif5a UTSW 10 127236815 nonsense probably null
R2012:Kif5a UTSW 10 127239175 missense probably benign
R2072:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2073:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2074:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2075:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2440:Kif5a UTSW 10 127231336 missense probably benign 0.34
R3157:Kif5a UTSW 10 127245441 missense probably damaging 1.00
R3688:Kif5a UTSW 10 127242774 missense probably damaging 1.00
R3740:Kif5a UTSW 10 127243468 missense probably damaging 1.00
R4782:Kif5a UTSW 10 127230954 missense probably benign 0.01
R5049:Kif5a UTSW 10 127239839 missense possibly damaging 0.93
R5723:Kif5a UTSW 10 127231029 frame shift probably null
R5764:Kif5a UTSW 10 127231029 frame shift probably null
R5838:Kif5a UTSW 10 127245441 missense probably damaging 1.00
R5903:Kif5a UTSW 10 127230578 missense probably benign 0.00
R6299:Kif5a UTSW 10 127233821 missense probably damaging 1.00
R6384:Kif5a UTSW 10 127242775 missense probably damaging 1.00
R6629:Kif5a UTSW 10 127248254 missense probably damaging 1.00
R7558:Kif5a UTSW 10 127248079 missense probably damaging 1.00
R7567:Kif5a UTSW 10 127237379 missense probably benign 0.00
R7733:Kif5a UTSW 10 127236740 missense probably benign 0.00
R7853:Kif5a UTSW 10 127235668 nonsense probably null
R7869:Kif5a UTSW 10 127243474 missense probably damaging 1.00
R7896:Kif5a UTSW 10 127242004 missense probably benign
R8085:Kif5a UTSW 10 127239309 missense probably benign 0.00
Z1177:Kif5a UTSW 10 127229823 missense probably benign 0.00
Z1177:Kif5a UTSW 10 127236967 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTTCTAGAGCAGGAGCAGACC -3'
(R):5'- TGCCGAATCCTAGAGTGCTTG -3'

Sequencing Primer
(F):5'- CAGACCGTGAATGTGAAAATGATTTC -3'
(R):5'- TGGCAGCCACCAATTCG -3'
Posted On2019-10-07