Incidental Mutation 'R7463:Timeless'
ID 578573
Institutional Source Beutler Lab
Gene Symbol Timeless
Ensembl Gene ENSMUSG00000039994
Gene Name timeless circadian clock 1
Synonyms tim
MMRRC Submission 045537-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7463 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 128067934-128088810 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128086295 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 999 (S999P)
Ref Sequence ENSEMBL: ENSMUSP00000058021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055539] [ENSMUST00000060782] [ENSMUST00000105242] [ENSMUST00000105243] [ENSMUST00000105244] [ENSMUST00000105245] [ENSMUST00000218722]
AlphaFold Q9R1X4
Predicted Effect probably benign
Transcript: ENSMUST00000055539
AA Change: S999P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000058021
Gene: ENSMUSG00000039994
AA Change: S999P

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.2e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060782
SMART Domains Protein: ENSMUSP00000059142
Gene: ENSMUSG00000051716

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipo_F 50 247 2.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105242
AA Change: S998P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000100876
Gene: ENSMUSG00000039994
AA Change: S998P

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.1e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 4.4e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105243
SMART Domains Protein: ENSMUSP00000100877
Gene: ENSMUSG00000039994

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 7.8e-104 PFAM
low complexity region 381 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105244
AA Change: S999P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000100878
Gene: ENSMUSG00000039994
AA Change: S999P

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.3e-103 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 5e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105245
AA Change: S999P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000100879
Gene: ENSMUSG00000039994
AA Change: S999P

DomainStartEndE-ValueType
Pfam:TIMELESS 24 284 1.1e-81 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218722
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: The protein encoded by this gene is highly conserved and is involved in cell survival after damage or stress, increase in DNA polymerase epsilon activity, maintenance of telomere length, and epithelial cell morphogenesis. The encoded protein also plays a role in the circadian rhythm autoregulatory loop, interacting with the PERIOD genes (PER1, PER2, and PER3) and others to downregulate activation of PER1 by CLOCK/ARNTL. Changes in this gene or its expression may promote prostate cancer, lung cancer, breast cancer, and mental disorders. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit early embryonic lethality at aprroximately the time of implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,634,698 (GRCm39) V435E probably damaging Het
Acta2 G A 19: 34,229,931 (GRCm39) T8I probably benign Het
Adcy2 T C 13: 68,878,399 (GRCm39) D413G probably damaging Het
Adgrg6 T A 10: 14,310,140 (GRCm39) D727V possibly damaging Het
Aebp2 C T 6: 140,583,452 (GRCm39) Q309* probably null Het
Amy1 A T 3: 113,363,533 (GRCm39) C43* probably null Het
Bpifc T C 10: 85,815,198 (GRCm39) E256G probably benign Het
Bysl A T 17: 47,913,396 (GRCm39) S296T probably benign Het
Carmil3 C T 14: 55,739,853 (GRCm39) P980L probably damaging Het
Coch T A 12: 51,640,408 (GRCm39) M1K probably null Het
Cpt2 A T 4: 107,765,354 (GRCm39) F137I probably damaging Het
Crem T C 18: 3,295,094 (GRCm39) I112V probably benign Het
Cul9 A G 17: 46,831,402 (GRCm39) probably null Het
Cyp3a41a T A 5: 145,650,374 (GRCm39) I90F probably damaging Het
Cyp4f16 C T 17: 32,769,761 (GRCm39) A457V possibly damaging Het
Ddx6 A G 9: 44,540,026 (GRCm39) E318G probably damaging Het
Dip2b A G 15: 100,052,038 (GRCm39) E213G probably benign Het
Dlx5 T C 6: 6,878,316 (GRCm39) H238R probably damaging Het
Dnai2 A C 11: 114,645,232 (GRCm39) I556L probably benign Het
Dnmt1 C T 9: 20,823,521 (GRCm39) V1147M possibly damaging Het
Egf G T 3: 129,533,664 (GRCm39) Q59K probably benign Het
Ermp1 A T 19: 29,623,662 (GRCm39) Y109* probably null Het
Fer1l6 T A 15: 58,445,450 (GRCm39) Y573* probably null Het
Fmnl1 T C 11: 103,083,954 (GRCm39) L503P probably damaging Het
Gnptab T G 10: 88,267,251 (GRCm39) I447M probably damaging Het
Hgf G A 5: 16,783,448 (GRCm39) D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Igf2r T C 17: 12,929,532 (GRCm39) T958A probably benign Het
Kcnd2 T A 6: 21,216,497 (GRCm39) L67Q probably damaging Het
Kif5a A G 10: 127,079,593 (GRCm39) V248A probably damaging Het
Krt33b A G 11: 99,920,389 (GRCm39) I88T probably damaging Het
Lhx2 G A 2: 38,241,858 (GRCm39) E25K possibly damaging Het
Mex3d C T 10: 80,217,532 (GRCm39) G562R Het
Myom2 A T 8: 15,167,679 (GRCm39) Y1088F probably null Het
Ncapg T A 5: 45,851,434 (GRCm39) probably null Het
Nudc A C 4: 133,261,714 (GRCm39) V190G possibly damaging Het
Obscn G T 11: 59,013,686 (GRCm39) R1054S probably benign Het
Or10g1 A G 14: 52,648,168 (GRCm39) W54R probably benign Het
Or10g9 A G 9: 39,911,860 (GRCm39) V221A probably benign Het
Or2d4 A T 7: 106,543,380 (GRCm39) V276E probably damaging Het
Or52h9 T C 7: 104,202,689 (GRCm39) S188P possibly damaging Het
Or56a5 T A 7: 104,793,144 (GRCm39) M119L probably benign Het
Or8j3 T C 2: 86,028,182 (GRCm39) M305V probably benign Het
Pcdh10 A T 3: 45,338,007 (GRCm39) R891S possibly damaging Het
Pcdh15 C T 10: 74,467,602 (GRCm39) S1873L possibly damaging Het
Pcdh7 A G 5: 57,878,340 (GRCm39) K632E probably benign Het
Pcdhgb8 G A 18: 37,896,480 (GRCm39) A517T probably damaging Het
Ptgr2 A T 12: 84,339,072 (GRCm39) probably benign Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Racgap1 T A 15: 99,540,839 (GRCm39) T4S probably benign Het
Rb1cc1 A G 1: 6,319,404 (GRCm39) H941R probably benign Het
Reln T C 5: 22,308,433 (GRCm39) H312R probably damaging Het
Rnf166 T A 8: 123,194,726 (GRCm39) H208L probably damaging Het
Spmap2 T C 10: 79,412,549 (GRCm39) E314G probably damaging Het
Tmem94 G T 11: 115,677,082 (GRCm39) R118L possibly damaging Het
Tor1aip1 A T 1: 155,883,355 (GRCm39) H349Q possibly damaging Het
Ttn T A 2: 76,750,804 (GRCm39) E3415V probably benign Het
Vmn2r102 A T 17: 19,896,886 (GRCm39) N78Y probably damaging Het
Wdr11 A T 7: 129,208,810 (GRCm39) D427V probably damaging Het
Zer1 A T 2: 30,003,449 (GRCm39) probably benign Het
Zfp516 T A 18: 82,975,233 (GRCm39) M477K probably benign Het
Other mutations in Timeless
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Timeless APN 10 128,077,577 (GRCm39) missense probably damaging 1.00
IGL02157:Timeless APN 10 128,078,255 (GRCm39) missense probably benign 0.01
IGL02300:Timeless APN 10 128,080,676 (GRCm39) missense probably benign 0.00
IGL02587:Timeless APN 10 128,075,785 (GRCm39) missense probably damaging 0.99
IGL02588:Timeless APN 10 128,079,203 (GRCm39) missense probably damaging 1.00
IGL02892:Timeless APN 10 128,080,120 (GRCm39) missense probably damaging 1.00
IGL02930:Timeless APN 10 128,083,060 (GRCm39) missense probably benign 0.00
IGL02986:Timeless APN 10 128,085,629 (GRCm39) missense possibly damaging 0.82
IGL03345:Timeless APN 10 128,083,455 (GRCm39) missense probably benign 0.04
IGL03393:Timeless APN 10 128,087,924 (GRCm39) missense probably damaging 1.00
R0388:Timeless UTSW 10 128,077,294 (GRCm39) splice site probably null
R0607:Timeless UTSW 10 128,082,203 (GRCm39) missense probably benign
R0638:Timeless UTSW 10 128,080,542 (GRCm39) nonsense probably null
R0734:Timeless UTSW 10 128,085,929 (GRCm39) missense probably damaging 1.00
R1346:Timeless UTSW 10 128,078,234 (GRCm39) missense possibly damaging 0.83
R1625:Timeless UTSW 10 128,076,493 (GRCm39) missense probably damaging 0.99
R1771:Timeless UTSW 10 128,083,477 (GRCm39) missense probably benign 0.11
R1860:Timeless UTSW 10 128,081,983 (GRCm39) missense probably benign 0.00
R1920:Timeless UTSW 10 128,077,583 (GRCm39) missense probably damaging 1.00
R1988:Timeless UTSW 10 128,080,056 (GRCm39) missense probably damaging 0.98
R2981:Timeless UTSW 10 128,084,327 (GRCm39) missense probably benign 0.34
R4359:Timeless UTSW 10 128,083,211 (GRCm39) missense probably benign 0.00
R4647:Timeless UTSW 10 128,075,825 (GRCm39) missense possibly damaging 0.80
R4753:Timeless UTSW 10 128,075,889 (GRCm39) utr 5 prime probably benign
R4868:Timeless UTSW 10 128,083,230 (GRCm39) missense probably benign
R4901:Timeless UTSW 10 128,086,631 (GRCm39) missense probably damaging 1.00
R4956:Timeless UTSW 10 128,077,520 (GRCm39) missense probably damaging 1.00
R5341:Timeless UTSW 10 128,083,047 (GRCm39) missense possibly damaging 0.81
R5439:Timeless UTSW 10 128,077,604 (GRCm39) missense probably damaging 1.00
R5585:Timeless UTSW 10 128,076,112 (GRCm39) missense probably damaging 0.97
R5842:Timeless UTSW 10 128,083,328 (GRCm39) critical splice donor site probably null
R5843:Timeless UTSW 10 128,080,113 (GRCm39) splice site probably null
R6005:Timeless UTSW 10 128,080,069 (GRCm39) missense probably damaging 0.99
R6271:Timeless UTSW 10 128,086,593 (GRCm39) missense probably damaging 1.00
R6558:Timeless UTSW 10 128,085,432 (GRCm39) missense probably benign 0.01
R6694:Timeless UTSW 10 128,075,868 (GRCm39) critical splice donor site probably null
R6738:Timeless UTSW 10 128,076,504 (GRCm39) missense probably damaging 1.00
R6760:Timeless UTSW 10 128,081,986 (GRCm39) missense probably benign 0.38
R7213:Timeless UTSW 10 128,079,158 (GRCm39) missense probably benign
R7248:Timeless UTSW 10 128,087,870 (GRCm39) missense probably benign
R7345:Timeless UTSW 10 128,085,623 (GRCm39) missense probably damaging 1.00
R7513:Timeless UTSW 10 128,085,399 (GRCm39) missense probably damaging 0.99
R7574:Timeless UTSW 10 128,080,538 (GRCm39) missense probably damaging 1.00
R8220:Timeless UTSW 10 128,082,265 (GRCm39) missense probably damaging 0.98
R8418:Timeless UTSW 10 128,086,605 (GRCm39) missense probably benign 0.02
R8742:Timeless UTSW 10 128,083,107 (GRCm39) missense probably benign 0.00
R8765:Timeless UTSW 10 128,080,412 (GRCm39) critical splice donor site probably null
R9508:Timeless UTSW 10 128,076,096 (GRCm39) missense probably benign 0.01
X0028:Timeless UTSW 10 128,086,194 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCCATGGGTGTACAGAAACCAG -3'
(R):5'- GTCATTTGCTGCTCGGATCAG -3'

Sequencing Primer
(F):5'- GAGGCCATTTTCTCATCCGTGTG -3'
(R):5'- TCGGATCAGGGAGCTCTG -3'
Posted On 2019-10-07